Hamburger Menu Button
Thermo Fisher Scientific Logo
Anmeldung
Sie haben noch kein Konto? Registrieren Sie sich hier
  • Produkte
    • Antikörper
    • Oligos, Primer, Sonden und Gene
    • TaqMan Real-Time PCR Assays
    • Zellkulturmedien
    • Chemikalien
    • Säulen und Kartuschen für die Chromatographie
    • Laborgeräte
    • Kunststoffartikel und Zubehör für das Labor
    • Mikrotiterplatten
    • Umweltfreundlichere Produkte
    • Alle Produktkategorien anzeigen
  • Anwendungen
    • Bioprocessing
    • Zellkultur und Transfektion
    • Zell- und Gentherapie
    • Chromatographie
    • Molekulare Testung
    • Digitale Lösungen
    • Extraktion und Analyse von DNA und RNA
    • Spektroskopie, Element- und Isotopenanalyse
    • Alle Anwendungen und Verfahren anzeigen
  • Service
    • 360° CDMO- und CRO-Services
    • CDMO-Services
    • CRO-Services
    • Kundenspezifische Services
    • Finanzierung und Leasing
    • Geräteservice
    • Laborinformatik
    • OEM und kommerzielle Bereitstellung
    • Schulungsdienstleistungen
    • Unity Lab Services
    • Alle Services anzeigen
  • Hilfe und Support
    • Für ein Konto registrieren
    • Bestellinformationen
    • Gerätesupport
    • Center für technischen Support
    • Lerncenter
    • Alle Themen für Hilfe und Support anzeigen
  • Häufigste Themen
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Für wen wir arbeiten
    • Biotechnologie
    • Biopharma
    • CDMO
    • Labordiagnostik
    • Angewandte Wissenschaften und Industrie
  • Sonderaktionen
  • Kontaktieren Sie uns
  • Eilbestellung
  • Status und Nachverfolgung von Bestellungen
  • Dokumente und Zertifikate
Thermo Fisher Scientific Logo

Search

Suchen in Alle
Search button
          • Auftragsstatus
          • Eilbestellung
          • Aktionen
          • Anmeldung
            Anmeldung
            Sie haben noch kein Konto? Registrieren Sie sich hier
            • Konto
            • Bestellungen
            • Connect: Labor, Daten, Apps
            • Spezialanfertigungen und Projekte
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_163056391_10
          See other RPS6KA5 GT Assays ›
          SNP ID:
          rs143846565
          Gene
          RPS6KA5
          Gene Name
          ribosomal protein S6 kinase A5
          Set Membership:
          -
          Chromosome Location:
          Chr.14: 90872089 - 90872089 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          CCTACCATGCCTAAGCTACTGAGTC[C/T]GAGAACTGGAAGAGGGTCTCCGGGT

          Assay ID C_163056391_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 603607

          Literature Links:

          RPS6KA5 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          RPS6KA5 - ribosomal protein S6 kinase A5
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001322227.1 2501 Silent Mutation TCA,TCG S,S 517 NP_001309156.1
          NM_001322228.1 2501 Silent Mutation TCA,TCG S,S 762 NP_001309157.1
          NM_001322229.1 2501 Silent Mutation TCA,TCG S,S 791 NP_001309158.1
          NM_001322230.1 2501 Silent Mutation TCA,TCG S,S 531 NP_001309159.1
          NM_001322231.1 2501 Silent Mutation TCA,TCG S,S 559 NP_001309160.1
          NM_001322232.1 2501 Silent Mutation TCA,TCG S,S 725 NP_001309161.1
          NM_001322233.1 2501 Silent Mutation TCA,TCG S,S 744 NP_001309162.1
          NM_001322234.1 2501 Silent Mutation TCA,TCG S,S 606 NP_001309163.1
          NM_001322235.1 2501 Silent Mutation TCA,TCG S,S 719 NP_001309164.1
          NM_001322236.1 2501 Silent Mutation TCA,TCG S,S 770 NP_001309165.1
          NM_001322237.1 2501 Silent Mutation TCA,TCG S,S 719 NP_001309166.1
          NM_001322238.1 2501 Silent Mutation TCA,TCG S,S 579 NP_001309167.1
          NM_004755.3 2501 Silent Mutation TCA,TCG S,S 798 NP_004746.2
          NM_182398.2 2501 Intron NP_872198.1
          XM_017021786.1 2501 Silent Mutation TCA,TCG S,S 579 XP_016877275.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          non-receptor serine/threonine protein kinase protein modifying enzyme

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of cytokine production
          stimulatory C-type lectin receptor signaling pathway
          regulation of transcription, DNA-templated
          protein phosphorylation
          inflammatory response
          epidermal growth factor receptor signaling pathway
          axon guidance
          histone phosphorylation
          positive regulation of CREB transcription factor activity
          positive regulation of histone phosphorylation
          positive regulation of histone acetylation
          intracellular signal transduction
          histone H3-S10 phosphorylation
          histone H3-S28 phosphorylation
          histone H2A-S1 phosphorylation
          negative regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          positive regulation of NF-kappaB transcription factor activity
          interleukin-1-mediated signaling pathway
          magnesium ion binding
          protein kinase activity
          protein serine/threonine kinase activity
          protein binding
          ATP binding
          histone kinase activity (H3-S10 specific)

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Bestellung Plus Icon Minus Icon
          • Auftragsstatus
          • Hilfe zu Bestellungen
          • Eilbestellung
          • Versorgungszentrum
          • Elektronische Beschaffung
          • Preis- und Frachtregeln
          Support Plus Icon Minus Icon
          • Hilfe und Support
          • Kontaktieren Sie uns
          • Center für technischen Support
          • Dokumente und Zertifikate
          • Meldung von Problemen auf der Webseite
          Ressourcen Plus Icon Minus Icon
          • Lerncenter
          • Sonderaktionen
          • Veranstaltungen und Webinare
          • Soziale Netzwerke
          Über Thermo Fisher Plus Icon Minus Icon
          • Über uns Über uns
          • Karriere Karriere
          • Investoren Investoren
          • News News
          • Soziale Verantwortung Soziale Verantwortung
          • Marken
          • Lieferkettensorgfaltspflichtengesetz
          • Richtlinien und Hinweise
          Unser Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Impressum
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-5xfkf:80/100.66.78.86:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline