Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_163144269_10
          See other INSM2 GT Assays ›
          SNP ID:
          rs146562217
          Gene
          INSM2 RALGAPA1
          Gene Name
          INSM transcriptional repressor 2
          Ral GTPase activating protein catalytic alpha subunit 1
          Set Membership:
          -
          Chromosome Location:
          Chr.14: 35539573 - 35539573 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          TTTATTGGCTGAGCCAGAGGAACGA[C/T]GCAGCTTCATGGACATGCGGCTTTT

          Assay ID C_163144269_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 614027 MIM: 608884

          Literature Links:

          INSM2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          T (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          T (0.01)
          (0.99)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          T (0.00)
          (1.00)
          AMR
          T (0.00)
          (1.00)
          INSM2 - INSM transcriptional repressor 2
          There are no transcripts associated with this gene.
          RALGAPA1 - Ral GTPase activating protein catalytic alpha subunit 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001283043.1 5880 Intron NP_001269972.1
          NM_001283044.1 5880 Intron NP_001269973.1
          NM_014990.1 5880 Intron NP_055805.1
          NM_194301.2 5880 Intron NP_919277.2
          XM_005267491.3 5880 Intron XP_005267548.1
          XM_005267492.3 5880 Intron XP_005267549.1
          XM_005267493.3 5880 Intron XP_005267550.1
          XM_005267498.4 5880 Missense Mutation CAT,CGT H,R 1316 XP_005267555.1
          XM_006720098.2 5880 Intron XP_006720161.1
          XM_006720099.2 5880 Intron XP_006720162.1
          XM_006720100.3 5880 Intron XP_006720163.1
          XM_006720101.2 5880 Intron XP_006720164.1
          XM_006720102.3 5880 Intron XP_006720165.1
          XM_006720103.2 5880 Intron XP_006720166.1
          XM_006720104.3 5880 Intron XP_006720167.1
          XM_011536615.2 5880 Intron XP_011534917.1
          XM_011536616.2 5880 Intron XP_011534918.1
          XM_017021141.1 5880 Intron XP_016876630.1
          XM_017021142.1 5880 Intron XP_016876631.1
          XM_017021143.1 5880 Intron XP_016876632.1
          XM_017021144.1 5880 Intron XP_016876633.1
          XM_017021145.1 5880 Intron XP_016876634.1
          XM_017021146.1 5880 Missense Mutation CAT,CGT H,R 1825 XP_016876635.1
          XM_017021147.1 5880 UTR 3 XP_016876636.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          GTPase-activating protein

          Gene Ontology Categories:

          Function(s) Process(es)

          regulation of transcription, DNA-templated
          regulation of small GTPase mediated signal transduction
          activation of GTPase activity
          GTPase activator activity
          protein heterodimerization activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          • Social Media
          • Contact Us
          • Report a Site Issue
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Argentina flag icon
          Argentina

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-b2k9d:80/100.66.79.173:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline