Search Thermo Fisher Scientific
- Order Status
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
CAATCGATCCAATCAGTGGCATGGA[C/T]GATCCTGGGGTAACAACTACCCGCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614547 MIM: 604799 | ||||||||||||||||||||
Literature Links: |
C15orf40 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C15orf40 - chromosome 15 open reading frame 40 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001160113.1 | Intron | NP_001153585.1 | ||||
NM_001160114.1 | Intron | NP_001153586.1 | ||||
NM_001160115.1 | Intron | NP_001153587.1 | ||||
NM_001160116.1 | Intron | NP_001153588.1 | ||||
NM_144597.2 | Intron | NP_653198.2 | ||||
XM_006720385.2 | Intron | XP_006720448.1 | ||||
XM_011521212.2 | Intron | XP_011519514.1 | ||||
XM_011521213.2 | Intron | XP_011519515.1 | ||||
XM_011521214.2 | Intron | XP_011519516.1 |
FAM103A1 - family with sequence similarity 103 member A1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_031452.3 | Intron | NP_113640.1 |
HOMER2 - homer scaffolding protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |