Search Thermo Fisher Scientific
- Contact Us
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
GCTGGGGAGGGCCTGTGGTGAGCTC[A/G]GTTGTAGGCTATGACCTGGTTGATC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 118888 MIM: 606967 MIM: 177015 MIM: 176847 | ||||||||||||||||||||
Literature Links: |
CTRL PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CTRL - chymotrypsin like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LCAT - lecithin-cholesterol acyltransferase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PSKH1 - protein serine kinase H1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006742.2 | Intron | NP_006733.1 |
PSMB10 - proteasome subunit beta 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |