Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGGCGCCGGTGTCTTTGGAAAAAT[C/T]GCCTAGTGACGTTTCAGCGTCCGAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 100710 MIM: 601514 MIM: 613936 | ||||||||||||||||||||
Literature Links: |
C17orf74 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C17orf74 - chromosome 17 open reading frame 74 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CHRNB1 - cholinergic receptor nicotinic beta 1 subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FGF11 - fibroblast growth factor 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC107983988 - proteoglycan 4-like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM102 - transmembrane protein 102 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001320444.1 | 1025 | Missense Mutation | TCG,TTG | S,L 209 | NP_001307373.1 | |
NM_178518.2 | 1025 | Missense Mutation | TCG,TTG | S,L 209 | NP_848613.1 |