Search Thermo Fisher Scientific
- Contact Us
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
GTTTTTCATAAAATCTACTGGTGGC[A/G]GGGGCAAGTTAAGTGAGTCAAGCGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 158381 MIM: 613113 MIM: 164345 | ||||||||||||||||||||
Literature Links: |
EVI2B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EVI2B - ecotropic viral integration site 2B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006495.3 | 1479 | Missense Mutation | CCG,CTG | P,L 405 | NP_006486.3 | |
XM_005257946.3 | 1479 | Missense Mutation | CCG,CTG | P,L 420 | XP_005258003.1 |
NF1 - neurofibromin 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000267.3 | 1479 | Intron | NP_000258.1 | |||
NM_001042492.2 | 1479 | Intron | NP_001035957.1 | |||
NM_001128147.2 | 1479 | Intron | NP_001121619.1 | |||
XM_005257983.2 | 1479 | Intron | XP_005258040.1 | |||
XM_005257984.2 | 1479 | Intron | XP_005258041.1 | |||
XM_006721922.2 | 1479 | Intron | XP_006721985.1 | |||
XM_006721924.2 | 1479 | Intron | XP_006721987.1 | |||
XM_006721925.2 | 1479 | Intron | XP_006721988.1 | |||
XM_006721926.3 | 1479 | Intron | XP_006721989.1 | |||
XM_011524852.2 | 1479 | Intron | XP_011523154.1 | |||
XM_011524857.2 | 1479 | Intron | XP_011523159.1 | |||
XM_017024689.1 | 1479 | Intron | XP_016880178.1 | |||
XM_017024690.1 | 1479 | Intron | XP_016880179.1 |
OMG - oligodendrocyte myelin glycoprotein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |