Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_164774063_10
          See other AURKB GT Assays ›
          SNP ID:
          rs149651741
          Gene
          AURKB
          Gene Name
          aurora kinase B
          Set Membership:
          -
          Chromosome Location:
          Chr.17: 8206543 - 8206543 on Build GRCh38
          Polymorphism:
          C/G, Transversion substitution
          Context Sequence [VIC/FAM]:

          CCGAAGTCAGCAATCTTCAGCTCTC[C/G]CTTGAGCCCTAAGAGCAGATTTTCT

          Assay ID C_164774063_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 604970

          Literature Links:

          AURKB PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          G (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          G (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          G (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          G (0.00)
          (1.00)
          AMR
          G (0.00)
          (1.00)
          AURKB - aurora kinase B
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001256834.2 747 Missense Mutation CGA,GGA R,G 171 NP_001243763.1
          NM_001284526.1 747 Missense Mutation CGA,GGA R,G 213 NP_001271455.1
          NM_001313950.1 747 Missense Mutation CGA,GGA R,G 212 NP_001300879.1
          NM_001313951.1 747 Intron NP_001300880.1
          NM_001313952.1 747 Missense Mutation CGA,GGA R,G 172 NP_001300881.1
          NM_001313953.1 747 Missense Mutation CGA,GGA R,G 180 NP_001300882.1
          NM_001313954.1 747 Missense Mutation CGA,GGA R,G 60 NP_001300883.1
          NM_001313955.1 747 Missense Mutation CGA,GGA R,G 44 NP_001300884.1
          NM_004217.3 747 Missense Mutation CGA,GGA R,G 212 NP_004208.2
          XM_011524070.2 747 Missense Mutation CGA,GGA R,G 180 XP_011522372.1
          XM_011524072.2 747 Missense Mutation CGA,GGA R,G 171 XP_011522374.1
          XM_017025307.1 747 Missense Mutation CGA,GGA R,G 171 XP_016880796.1
          XM_017025308.1 747 Missense Mutation CGA,GGA R,G 139 XP_016880797.1
          XM_017025309.1 747 Missense Mutation CGA,GGA R,G 60 XP_016880798.1
          XM_017025310.1 747 Missense Mutation CGA,GGA R,G 60 XP_016880799.1
          XM_017025311.1 747 Missense Mutation CGA,GGA R,G 60 XP_016880800.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          non-receptor serine/threonine protein kinase

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          negative regulation of B cell apoptotic process
          protein phosphorylation
          spindle organization
          sister chromatid cohesion
          aging
          cell proliferation
          attachment of spindle microtubules to kinetochore
          abscission
          histone modification
          protein sumoylation
          anaphase-promoting complex-dependent catabolic process
          spindle checkpoint
          negative regulation of protein binding
          positive regulation of telomere maintenance via telomerase
          negative regulation of cytokinesis
          positive regulation of cytokinesis
          protein localization to kinetochore
          cellular response to UV
          cleavage furrow formation
          protein ubiquitination involved in ubiquitin-dependent protein catabolic process
          histone H3-S28 phosphorylation
          protein autophosphorylation
          mitotic spindle midzone assembly
          positive regulation of telomerase activity
          regulation of chromosome segregation
          regulation of signal transduction by p53 class mediator
          positive regulation of telomere capping
          protein serine/threonine kinase activity
          protein serine/threonine/tyrosine kinase activity
          protein binding
          ATP binding
          histone serine kinase activity
          metal ion binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline