Hamburger Menu Button
Thermo Fisher Scientific Logo
로그인
회원이 아니신가요? 계정 생성하기
  • 모든 제품 주문
    • 항체
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR 분석
    • 피펫 및 피펫 팁
    • 실험실용 원심분리기
    • 초저온 냉동고
    • 분광학
    • 비이커
    • PCR 장비 및 용품
    • 제품 카테고리 전체보기
  • 응용 분야 및 기법
    • 세포 분석
    • 실험실 장비
    • Real-Time PCR
    • PCR
    • 크로마토그래피
    • 세포 배양 및 트랜스펙션
    • DNA/RNA 추출과 분석
    • 단백질 생물학
    • 유세포분석
    • 화학 제품
    • 응용 분야 및 기법 전체보기
  • 서비스
    • 맞춤형 서비스
    • 엔터프라이즈급 실험실 정보 처리
    • 엔터프라이즈 서비스
    • 360° CDMO 및 CRO 서비스
    • CDMO 서비스
    • 임상 시험 CRO 서비
    • 장비 서비스
    • 교육 서비스
    • 서비스 전체 보기
  • 지원
    • 고객센터
    • 문의하기
    • 시험성적서(COA) 및 적합성 인증서(COC)
    • Safety Data Sheets (SDS)
    • 매뉴얼
    • 인용 및 참고 문헌
    • 기기 지원
    • 기술 자료/제품 FAQ
    • 학습 센터
    • 지원 메뉴 전체보기
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • 문의하기
  • 빠른 주문
  • 주문 현황
  • 제품 문서 검색
Thermo Fisher Scientific Logo

Search

전체검색
Search button
          • 주문 현황
          • 빠른주문
          • 로그인
            로그인
            회원이 아니신가요? 계정 생성하기
            • 계정정보
            • 주문내역조회
            • 커스텀제품 및 프로젝트
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_165344569_10
          See other ABCA7 GT Assays ›
          SNP ID:
          rs142291535
          Gene
          ABCA7 CNN2
          Gene Name
          ATP binding cassette subfamily A member 7
          calponin 2
          Set Membership:
          -
          Chromosome Location:
          Chr.19: 1045056 - 1045056 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          ACCCTCAGAGGCAGCCCTGGTGTCG[C/T]GGGCCCTGCAACTGCTCGCGGAACA

          Assay ID C_165344569_10
          Size
          재고 정보 주문접수 후 제작
          Catalog # 4351379
          제품 정가
          Your Price
          온라인 행사가:
          공급가 확인 ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay 상세 정보



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 605414 MIM: 602373

          Literature Links:

          ABCA7 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          ABCA7 - ATP binding cassette subfamily A member 7
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_019112.3 1488 Missense Mutation CGG,TGG R,W 424 NP_061985.2
          XM_006722616.1 1488 Missense Mutation CGG,TGG R,W 424 XP_006722679.1
          XM_006722617.2 1488 Missense Mutation CGG,TGG R,W 424 XP_006722680.1
          XM_006722618.2 1488 Intron XP_006722681.1
          XM_011527628.2 1488 Missense Mutation CGG,TGG R,W 424 XP_011525930.1
          XM_011527629.1 1488 Missense Mutation CGG,TGG R,W 424 XP_011525931.1
          XM_011527630.1 1488 Missense Mutation CGG,TGG R,W 424 XP_011525932.1
          XM_011527631.1 1488 Missense Mutation CGG,TGG R,W 424 XP_011525933.1
          XM_011527632.1 1488 Missense Mutation CGG,TGG R,W 272 XP_011525934.1
          XM_011527633.2 1488 Missense Mutation CGG,TGG R,W 424 XP_011525935.1
          XM_011527634.1 1488 Missense Mutation CGG,TGG R,W 424 XP_011525936.1
          XM_011527635.1 1488 Missense Mutation CGG,TGG R,W 424 XP_011525937.1
          XM_011527636.2 1488 Intron XP_011525938.1
          XM_017026142.1 1488 Missense Mutation CGG,TGG R,W 424 XP_016881631.1
          XM_017026143.1 1488 Missense Mutation CGG,TGG R,W 424 XP_016881632.1
          CNN2 - calponin 2
          There are no transcripts associated with this gene.

          Back To Top

          추가 정보


          Panther Classification:

          Molecular Function -

          ATP-binding cassette (ABC) transporter primary active transporter transporter

          Gene Ontology Categories:

          Function(s) Process(es)

          phagocytosis
          memory
          positive regulation of cholesterol efflux
          phospholipid scrambling
          peptide cross-linking
          negative regulation of ATPase activity
          positive regulation of ATPase activity
          cholesterol efflux
          phospholipid efflux
          high-density lipoprotein particle assembly
          protein localization to nucleus
          apolipoprotein A-I-mediated signaling pathway
          negative regulation of amyloid precursor protein biosynthetic process
          positive regulation of phagocytosis
          transmembrane transport
          positive regulation of ERK1 and ERK2 cascade
          positive regulation of beta-amyloid clearance
          positive regulation of engulfment of apoptotic cell
          negative regulation of beta-amyloid formation
          positive regulation of phospholipid efflux
          transporter activity
          ATP binding
          phospholipid transporter activity
          ATPase activity
          apolipoprotein A-I receptor activity
          ATPase activity, coupled to transmembrane movement of substances

          Back To Top

          관련 제품

          • TaqMan® Genotyping Master Mix
          온라인 주문 Plus Icon Minus Icon
          • 주문 현황
          • 주문 지원
          • 빠른 주문
          • Supply Center
          • eProcurement
          지원 Plus Icon Minus Icon
          • Help and Support
          • 고객 센터
          • 기술 지원 센터
          • 제품 문서 검색
          • 사이트 문제 보고
          교육 및 이벤트 Plus Icon Minus Icon
          • 교육 센터
          • 프로모션
          • 이벤트 및 웨비나
          • 소셜 미디어
          About Thermo Fisher Plus Icon Minus Icon
          • 소개 소개
          • 채용 채용
          • 투자자 투자자
          • 뉴스 뉴스
          • 사회적 책임 사회적 책임
          • Trademarks
          • 공정거래 공정거래
          • 정책 및 고지
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • 이용 약관
          • 개인정보 처리방침
          • 가격 및 운임 정책
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Korea flag icon
          Korea

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          써모 피셔 사이언티픽 코리아 주식회사
          대표자 : 석수진
          사업자 등록번호 : 117-81-46910
          입금계좌 : 하나은행 336-890014-06204
          (예금주 : 써모피셔사이언티픽코리아 주식회사)

           

          써모 피셔 사이언티픽 솔루션스 유한회사
          대표자 : 석수진
          사업자 등록번호 : 114-86-04783
          입금계좌 : 신한은행 140-004-396660
          (예금주 : 써모피셔사이언티픽솔루션스 유한회사)

           

          주소 : 서울시 강남구 광평로 281 수서오피스빌딩 12층 06349 | 통신판매업신고번호 : 2015-서울강남-00898

          ISMS Logo

          Your items have has been added!


          Host server : magellan-search-blue-55ff9ddd88-gbx7x:80/100.66.75.107:80.
          git-commit: d366ff9721d93504b2ac26a183b2b3e3d0e7d9ec
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.42.0-2026.01.03-1.0