Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_165404585_10
          See other ACTN4 GT Assays ›
          SNP ID:
          rs144919021
          Gene
          ACTN4 CAPN12
          Gene Name
          actinin alpha 4
          calpain 12
          Set Membership:
          -
          Chromosome Location:
          Chr.19: 38731175 - 38731175 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          GAAGTCCACACGCAGACGGCTATCC[C/T]GGTAGCGGCTGGTGAGGGTCTGGGT

          Assay ID C_165404585_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 604638 MIM: 608839

          Literature Links:

          ACTN4 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          T (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          T (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          T (0.00)
          (1.00)
          AMR
          T (0.00)
          (1.00)
          ACTN4 - actinin alpha 4
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001322033.1 2255 Intron NP_001308962.1
          NM_004924.5 2255 Intron NP_004915.2
          XM_005259281.4 2255 Intron XP_005259338.1
          XM_006723406.2 2255 Intron XP_006723469.1
          XM_017027331.1 2255 Intron XP_016882820.1
          CAPN12 - calpain 12
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_144691.4 2255 Missense Mutation CAG,CGG Q,R 669 NP_653292.2
          XM_017026355.1 2255 Missense Mutation CAG,CGG Q,R 673 XP_016881844.1
          XM_017026356.1 2255 Missense Mutation CAG,CGG Q,R 652 XP_016881845.1
          XM_017026357.1 2255 Missense Mutation CAG,CGG Q,R 649 XP_016881846.1
          XM_017026358.1 2255 Missense Mutation CAG,CGG Q,R 648 XP_016881847.1
          XM_017026359.1 2255 Intron XP_016881848.1
          XM_017026360.1 2255 Missense Mutation CAG,CGG Q,R 602 XP_016881849.1
          XM_017026361.1 2255 Intron XP_016881850.1
          XM_017026362.1 2255 Intron XP_016881851.1
          XM_017026363.1 2255 UTR 3 XP_016881852.1
          XM_017026364.1 2255 Missense Mutation CAG,CGG Q,R 478 XP_016881853.1
          XM_017026365.1 2255 Intron XP_016881854.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          cysteine protease

          Gene Ontology Categories:

          Function(s) Process(es)

          response to hypoxia
          platelet degranulation
          protein transport
          vesicle transport along actin filament
          positive regulation of cell migration
          positive regulation of sodium:proton antiporter activity
          peroxisome proliferator activated receptor signaling pathway
          regulation of apoptotic process
          retinoic acid receptor signaling pathway
          positive regulation of pinocytosis
          actin filament bundle assembly
          negative regulation of cellular component movement
          positive regulation of cellular component movement
          bicellular tight junction assembly
          negative regulation of substrate adhesion-dependent cell spreading
          positive regulation of NIK/NF-kappaB signaling
          protein localization to bicellular tight junction
          regulation of nucleic acid-templated transcription
          proteolysis
          RNA polymerase II regulatory region sequence-specific DNA binding
          nucleoside binding
          actin binding
          integrin binding
          calcium ion binding
          protein binding
          ligand-dependent nuclear receptor transcription coactivator activity
          chromatin DNA binding
          nuclear hormone receptor binding
          protein homodimerization activity
          retinoic acid receptor binding
          ion channel binding
          poly(A) RNA binding
          protein N-terminus binding
          actin filament binding
          calcium-dependent cysteine-type endopeptidase activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-fkn7b:80/100.66.79.246:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline