Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACTGGGAGCCCTAGGGGATCCAGTG[A/G]CATCGTCTCGGGACACACGCAGGTA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 111100 MIM: 136836 | ||||||||||||||||||||
Literature Links: |
FUT3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FUT3 - fucosyltransferase 3 (Lewis blood group) | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000149.3 | 760 | Missense Mutation | GCC,GTC | A,V 41 | NP_000140.1 | |
NM_001097639.1 | 760 | Missense Mutation | GCC,GTC | A,V 41 | NP_001091108.1 | |
NM_001097640.1 | 760 | Missense Mutation | GCC,GTC | A,V 41 | NP_001091109.1 | |
NM_001097641.1 | 760 | Missense Mutation | GCC,GTC | A,V 41 | NP_001091110.1 | |
XM_011527865.1 | 760 | Missense Mutation | GCC,GTC | A,V 41 | XP_011526167.1 | |
XM_011527866.1 | 760 | Missense Mutation | GCC,GTC | A,V 41 | XP_011526168.1 | |
XM_011527867.1 | 760 | Missense Mutation | GCC,GTC | A,V 41 | XP_011526169.1 |
FUT6 - fucosyltransferase 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101928844 - uncharacterized LOC101928844 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |