Search Thermo Fisher Scientific
- Order Status
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
CGGTGGAGAGCCGCAGCTGCCCGCC[C/G]CGGGGCCCCAGGCGCAGCACGCTCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
1 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 602943 MIM: 615653 | ||||||||||||||||||||
Literature Links: |
C2CD4D PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C2CD4D - C2 calcium dependent domain containing 4D | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001136003.1 | 1700 | Silent Mutation | CGC,CGG | R,R 217 | NP_001129475.1 | |
XM_011509055.2 | 1700 | Silent Mutation | CGC,CGG | R,R 217 | XP_011507357.1 | |
XM_016999989.1 | 1700 | Silent Mutation | CGC,CGG | R,R 217 | XP_016855478.1 |
LOC100132111 - uncharacterized LOC100132111 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RORC - RAR related orphan receptor C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
THEM5 - thioesterase superfamily member 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |