Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_165950779_10
          See other CLCN6 GT Assays ›
          SNP ID:
          rs115986455
          Gene
          CLCN6 MTHFR
          Gene Name
          chloride voltage-gated channel 6
          methylenetetrahydrofolate reductase (NAD(P)H)
          Set Membership:
          -
          Chromosome Location:
          Chr.1: 11806754 - 11806754 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          CTGGGTCACTGACAGTCCAGCTTCC[C/T]CCTGCAAAGCATCCTGGGAAAACTT

          Assay ID C_165950779_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          9 submissions

          Phenotype:

          MIM: 602726 MIM: 607093

          Literature Links:

          CLCN6 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          T (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          T (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          T (0.00)
          (1.00)
          AMR
          T (0.00)
          (1.00)
          CLCN6 - chloride voltage-gated channel 6
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001256959.1 Intron NP_001243888.1
          NM_001286.3 Intron NP_001277.1
          MTHFR - methylenetetrahydrofolate reductase (NAD(P)H)
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_005957.4 Intron NP_005948.3
          XM_005263458.3 Intron XP_005263515.1
          XM_005263460.4 Intron XP_005263517.1
          XM_005263462.4 Intron XP_005263519.1
          XM_005263463.3 Intron XP_005263520.1
          XM_011541495.2 Intron XP_011539797.1
          XM_011541496.2 Intron XP_011539798.1
          XM_017001328.1 Intron XP_016856817.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          ion channel reductase

          Gene Ontology Categories:

          Function(s) Process(es)

          chloride transport
          cell volume homeostasis
          signal transduction
          response to mechanical stimulus
          ion transmembrane transport
          chloride transmembrane transport
          regulation of anion transmembrane transport
          response to hypoxia
          cellular amino acid metabolic process
          methionine metabolic process
          blood circulation
          regulation of histone methylation
          response to vitamin B2
          tetrahydrofolate interconversion
          response to drug
          response to amino acid
          S-adenosylmethionine metabolic process
          folic acid metabolic process
          homocysteine metabolic process
          response to folic acid
          oxidation-reduction process
          response to interleukin-1
          heterochromatin maintenance
          voltage-gated chloride channel activity
          ATP binding
          antiporter activity
          chloride ion binding
          methylenetetrahydrofolate reductase (NAD(P)H) activity
          protein complex binding
          flavin adenine dinucleotide binding
          NADP binding
          modified amino acid binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-7b6576f7bc-d59m7:80/100.66.79.221:80.
          git-commit: 6d309ebe7a31b2ceadeb87f43b473eebab110cf3
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-2026.03.11-1.0