Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Western Blot Products
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Food and Beverage
    • Lab Solutions
    • Pharma and Biopharma
    • Real-Time PCR
    • Semiconductor Analysis
    • Clinical and Diagnostics
    • Digital Solutions
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • See all services
  • Help and Support
    • Order Help
    • Digital Solutions
    • Product Support
    • Technical Information
    • Training and Education
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_166026712_10
          See other DISC1 GT Assays ›
          SNP ID:
          rs117884450
          Gene
          DISC1 DISC2 TSNAX-DISC1
          Gene Name
          disrupted in schizophrenia 1
          disrupted in schizophrenia 2 (non-protein coding)
          TSNAX-DISC1 readthrough (NMD candidate)
          Set Membership:
          -
          Chromosome Location:
          Chr.1: 231818345 - 231818345 on Build GRCh38
          Polymorphism:
          A/G, Transition Substitution
          Context Sequence [VIC/FAM]:

          GTGCTGTAGGAAACCATTTCTGGAC[A/G]GCTAAAGACCTCACCGAGGAGATTA

          Assay ID C_166026712_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          7 submissions

          Phenotype:

          MIM: 605210 MIM: 606271

          Literature Links:

          DISC1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          A (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          A (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          A (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          A (0.00)
          (1.00)
          AMR
          A (0.00)
          (1.00)
          DISC1 - disrupted in schizophrenia 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001012957.1 654 Silent Mutation ACA,ACG T,T 603 NP_001012975.1
          NM_001012958.1 654 Intron NP_001012976.1
          NM_001012959.1 654 Silent Mutation ACA,ACG T,T 603 NP_001012977.1
          NM_001164537.1 654 Silent Mutation ACA,ACG T,T 635 NP_001158009.1
          NM_001164538.1 654 Silent Mutation ACA,ACG T,T 603 NP_001158010.1
          NM_001164539.1 654 Silent Mutation ACA,ACG T,T 603 NP_001158011.1
          NM_001164540.1 654 Silent Mutation ACA,ACG T,T 481 NP_001158012.1
          NM_001164541.1 654 Silent Mutation ACA,ACG T,T 603 NP_001158013.1
          NM_001164542.1 654 Silent Mutation ACA,ACG T,T 603 NP_001158014.1
          NM_001164544.1 654 Silent Mutation ACA,ACG T,T 603 NP_001158016.1
          NM_001164545.1 654 Missense Mutation CAG,CGG Q,R 569 NP_001158017.1
          NM_001164546.1 654 Intron NP_001158018.1
          NM_001164547.1 654 Intron NP_001158019.1
          NM_001164548.1 654 Missense Mutation AGC,GGC S,G 551 NP_001158020.1
          NM_001164549.1 654 Intron NP_001158021.1
          NM_001164550.1 654 Intron NP_001158022.1
          NM_001164551.1 654 Intron NP_001158023.1
          NM_001164552.1 654 Intron NP_001158024.1
          NM_001164553.1 654 Intron NP_001158025.1
          NM_001164554.1 654 Intron NP_001158026.1
          NM_001164555.1 654 Intron NP_001158027.1
          NM_001164556.1 654 Missense Mutation AGC,GGC S,G 201 NP_001158028.1
          NM_018662.2 654 Silent Mutation ACA,ACG T,T 603 NP_061132.2
          DISC2 - disrupted in schizophrenia 2 (non-protein coding)
          There are no transcripts associated with this gene.
          TSNAX-DISC1 - TSNAX-DISC1 readthrough (NMD candidate)
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Additional Information:

          For this assay, SNP(s) [rs12133766] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

          Gene Ontology Categories:

          Function(s) Process(es)

          microtubule cytoskeleton organization
          neuron migration
          positive regulation of cell-matrix adhesion
          positive regulation of neuroblast proliferation
          cell proliferation in forebrain
          pyramidal neuron migration
          positive regulation of Wnt signaling pathway
          TOR signaling
          nonmotile primary cilium assembly
          positive regulation of axon extension
          mitochondrial calcium ion homeostasis
          response to electrical stimulus
          canonical Wnt signaling pathway
          regulation of dendritic spine development
          protein localization to centrosome
          regulation of synapse maturation
          positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process
          protein binding
          kinesin binding
          protein complex binding
          protein complex scaffold

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Taiwan flag icon
          Taiwan

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline