Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTCTCCTGCTGCCTCTTCTGAAGAA[C/T]CTCCGTTTGCACCTGTGATATGAAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
3 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 614259 MIM: 614443 | ||||||||||||||||||||
Literature Links: |
CFAP57 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CFAP57 - cilia and flagella associated protein 57 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EBNA1BP2 - EBNA1 binding protein 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001159936.1 | 864 | Missense Mutation | ATT,GTT | I,V 239 | NP_001153408.1 | |
NM_006824.2 | 864 | Missense Mutation | ATT,GTT | I,V 184 | NP_006815.2 |
MIR6733 - microRNA 6733 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |