Search
LOADING 
- SNP ID:
- rs145204276
- Gene
-
DARS2GAS5GAS5-AS1SNORA103SNORD44SNORD47SNORD74SNORD75SNORD76SNORD77SNORD78SNORD79SNORD80SNORD81ZBTB37 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.1: 173868254 - 173868258 on Build GRCh38
- Polymorphism:
- AGGCA/-, Insertion/deletion
- Context Sequence [VIC/FAM]:
GAGCAGAGAGGGGAGGGGGCGCG[AGGCA/-]AGGAAAGCTCTGGGGATGGGGGA
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
13 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610956
MIM: 608280
|
||||||||||||||||||||||||||||||||||||||
Literature Links: |
DARS2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap | |||
|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
| DARS2 - aspartyl-tRNA synthetase 2, mitochondrial | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| GAS5 - growth arrest specific 5 (non-protein coding) | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| GAS5-AS1 - GAS5 antisense RNA 1 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| SNORA103 - small nucleolar RNA, H/ACA box 103 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| SNORD44 - small nucleolar RNA, C/D box 44 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| SNORD47 - small nucleolar RNA, C/D box 47 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| SNORD74 - small nucleolar RNA, C/D box 74 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| SNORD75 - small nucleolar RNA, C/D box 75 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| SNORD76 - small nucleolar RNA, C/D box 76 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| SNORD77 - small nucleolar RNA, C/D box 77 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| SNORD78 - small nucleolar RNA, C/D box 78 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| SNORD79 - small nucleolar RNA, C/D box 79 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| SNORD80 - small nucleolar RNA, C/D box 80 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| SNORD81 - small nucleolar RNA, C/D box 81 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| ZBTB37 - zinc finger and BTB domain containing 37 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001122770.1 | 160 | Intron | NP_001116242.1 | |||
| NM_032522.3 | 160 | Intron | NP_115911.1 | |||
| XM_005245546.2 | 160 | Intron | XP_005245603.1 | |||
| XM_006711578.3 | 160 | UTR 5 | XP_006711641.1 | |||
| XM_011510062.2 | 160 | Intron | XP_011508364.1 | |||
| XM_017002556.1 | 160 | Intron | XP_016858045.1 | |||
| XM_017002557.1 | 160 | Intron | XP_016858046.1 | |||
| XM_017002558.1 | 160 | Intron | XP_016858047.1 | |||
Back To Top