Search
LOADING 
- SNP ID:
- rs146711061
- Gene
-
CD58IGSF3 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.1: 116579510 - 116579510 on Build GRCh38
- Polymorphism:
- A/G, Transition Substitution
- Context Sequence [VIC/FAM]:
GGCAGGAGTAATTGCCTGTATCTTG[A/G]GGGCTTGCCTGCAGCACTGTGAGCC
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
1 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 153420
MIM: 603491
|
||||||||||||||||||||
Literature Links: |
CD58 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| CD58 - CD58 molecule | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| IGSF3 - immunoglobulin superfamily member 3 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001007237.2 | 3906 | Silent Mutation | CCC,CCT | P,P 1072 | NP_001007238.1 | |
| NM_001542.3 | 3906 | Silent Mutation | CCC,CCT | P,P 1092 | NP_001533.2 | |
| XM_005270793.2 | 3906 | Silent Mutation | CCC,CCT | P,P 1092 | XP_005270850.1 | |
| XM_005270794.4 | 3906 | Silent Mutation | CCC,CCT | P,P 1077 | XP_005270851.1 | |
| XM_006710593.3 | 3906 | Silent Mutation | CCC,CCT | P,P 1097 | XP_006710656.1 | |
| XM_011541315.1 | 3906 | Silent Mutation | CCC,CCT | P,P 1092 | XP_011539617.1 | |
| XM_011541316.2 | 3906 | Silent Mutation | CCC,CCT | P,P 535 | XP_011539618.1 | |
Back To TopMore Information
Additional Information:
For this assay, SNP(s) [rs6703791] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Ontology Categories:
Back To Top