Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_166817041_10
          See other ATP2B4 GT Assays ›
          SNP ID:
          rs148124582
          Gene
          ATP2B4
          Gene Name
          ATPase plasma membrane Ca2+ transporting 4
          Set Membership:
          -
          Chromosome Location:
          Chr.1: 203639941 - 203639941 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          AGCCTCTTAATCCCTATTTTCAGAG[A/G]CAATGTGGTATAAAGGATAAAGGAG

          Assay ID C_166817041_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          14 submissions

          Phenotype:

          MIM: 108732

          Literature Links:

          ATP2B4 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.01)
          (0.99)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          A (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          A (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          A (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          A (0.02)
          (0.98)
          AMR
          A (0.01)
          (0.99)
          ATP2B4 - ATPase plasma membrane Ca2+ transporting 4
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001001396.2 Intron NP_001001396.1
          NM_001684.4 Intron NP_001675.3

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          primary active transporter

          Gene Ontology Categories:

          Function(s) Process(es)

          neural retina development
          regulation of transcription from RNA polymerase II promoter
          cellular calcium ion homeostasis
          spermatogenesis
          negative regulation of nitric oxide mediated signal transduction
          hippocampus development
          sperm motility
          positive regulation of peptidyl-serine phosphorylation
          ion transmembrane transport
          negative regulation of nitric oxide biosynthetic process
          negative regulation of nitric-oxide synthase activity
          response to hydrostatic pressure
          calcium ion transmembrane transport
          negative regulation of calcineurin-NFAT signaling cascade
          cellular response to epinephrine stimulus
          calcium ion transmembrane import into cytosol
          calcium ion import across plasma membrane
          negative regulation of the force of heart contraction
          negative regulation of arginine catabolic process
          negative regulation of adrenergic receptor signaling pathway involved in heart process
          calcium ion export
          negative regulation of peptidyl-cysteine S-nitrosylation
          regulation of sodium ion transmembrane transport
          regulation of cell cycle G1/S phase transition
          negative regulation of cardiac muscle hypertrophy in response to stress
          negative regulation of citrulline biosynthetic process
          regulation of cardiac conduction
          positive regulation of cAMP-dependent protein kinase activity
          calcium-transporting ATPase activity
          protein binding
          calmodulin binding
          ATP binding
          sodium channel regulator activity
          PDZ domain binding
          protein phosphatase 2B binding
          nitric-oxide synthase inhibitor activity
          metal ion binding
          nitric-oxide synthase binding
          scaffold protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          • Price & Freight Policy
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • German Supply Chain Due Diligence Act
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Legal Notice
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-b2k9d:80/100.66.79.173:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline