Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Veja todas as categorias de produtos
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Pedidos
            • Productos y proyectos personalizados
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_167152366_10
          See other UCKL1 GT Assays ›
          SNP ID:
          rs140814572
          Gene
          UCKL1 UCKL1-AS1 ZNF512B
          Gene Name
          uridine-cytidine kinase 1 like 1
          UCKL1 antisense RNA 1
          zinc finger protein 512B
          Set Membership:
          -
          Chromosome Location:
          Chr.20: 63959938 - 63959938 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          CCCACCTTCCGGCCGGTGGAGCCCC[A/G]GGCCCCCTTGTCTCTGCATCCTGGA

          Assay ID C_167152366_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 610866

          Literature Links:

          UCKL1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          UCKL1 - uridine-cytidine kinase 1 like 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001193379.1 2760 Intron NP_001180308.1
          NM_017859.3 2760 Intron NP_060329.2
          XM_005260216.2 2760 Intron XP_005260273.1
          XM_006723806.2 2760 Intron XP_006723869.1
          XM_006723807.2 2760 Intron XP_006723870.1
          XM_006723808.1 2760 Intron XP_006723871.1
          XM_006723809.1 2760 Intron XP_006723872.1
          XM_006723810.1 2760 Intron XP_006723873.1
          XM_006723811.3 2760 Intron XP_006723874.1
          XM_011528868.2 2760 Intron XP_011527170.1
          XM_011528869.1 2760 Intron XP_011527171.1
          XM_011528870.1 2760 Intron XP_011527172.1
          XM_011528871.1 2760 Intron XP_011527173.1
          XM_011528872.1 2760 Intron XP_011527174.1
          XM_011528873.2 2760 Intron XP_011527175.1
          XM_017027894.1 2760 Intron XP_016883383.1
          XM_017027895.1 2760 Intron XP_016883384.1
          XM_017027896.1 2760 Intron XP_016883385.1
          XM_017027897.1 2760 Intron XP_016883386.1
          XM_017027898.1 2760 Intron XP_016883387.1
          XM_017027899.1 2760 Intron XP_016883388.1
          XM_017027900.1 2760 Intron XP_016883389.1
          XM_017027901.1 2760 Intron XP_016883390.1
          XM_017027902.1 2760 Intron XP_016883391.1
          XM_017027903.1 2760 Intron XP_016883392.1
          XM_017027904.1 2760 Intron XP_016883393.1
          XM_017027905.1 2760 Intron XP_016883394.1
          XM_017027906.1 2760 Intron XP_016883395.1
          XM_017027907.1 2760 Intron XP_016883396.1
          XM_017027908.1 2760 Intron XP_016883397.1
          UCKL1-AS1 - UCKL1 antisense RNA 1
          There are no transcripts associated with this gene.
          ZNF512B - zinc finger protein 512B
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_020713.2 2760 Missense Mutation CGG,TGG R,W 877 NP_065764.1
          XM_005260226.3 2760 Missense Mutation CGG,TGG R,W 891 XP_005260283.1
          XM_011528929.2 2760 Missense Mutation CGG,TGG R,W 877 XP_011527231.1
          XM_011528930.2 2760 Missense Mutation CGG,TGG R,W 858 XP_011527232.1
          XM_011528931.2 2760 Missense Mutation CGG,TGG R,W 547 XP_011527233.1
          XM_011528932.2 2760 Missense Mutation CGG,TGG R,W 546 XP_011527234.1
          XM_011528933.2 2760 Intron XP_011527235.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          nucleotide kinase

          Gene Ontology Categories:

          Function(s) Process(es)

          pyrimidine nucleobase metabolic process
          viral process
          phosphorylation
          pyrimidine nucleoside salvage
          UMP salvage
          CTP salvage
          transcription, DNA-templated
          regulation of transcription, DNA-templated
          uridine kinase activity
          protein binding
          ATP binding
          DNA binding
          metal ion binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Argentina flag icon
          Argentina

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-pgj68:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline