Search
LOADING 
- SNP ID:
- rs113467703
- Gene
-
KRTAP22-1KRTAP22-2KRTAP6-2KRTAP6-3 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.21: 30598757 - 30598757 on Build GRCh38
- Polymorphism:
- A/G, Transition substitution
- Context Sequence [VIC/FAM]:
AAGCGGGAGCCGTAGCCATGACCAT[A/G]GCCACAGCAGGAGCTATAGCCACAG
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
KRTAP22-1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| KRTAP22-1 - keratin associated protein 22-1 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| KRTAP22-2 - keratin associated protein 22-2 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| KRTAP6-2 - keratin associated protein 6-2 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_181604.1 | 118 | Missense Mutation | CAT,TAT | H,Y 40 | NP_853635.1 | |
| KRTAP6-3 - keratin associated protein 6-3 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
Back To Top