Search
LOADING 
- SNP ID:
- rs143991895
- Gene
-
DDTDDTLGSTT2LOC107985559 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.22: 23971569 - 23971569 on Build GRCh38
- Polymorphism:
- C/T, Transition substitution
- Context Sequence [VIC/FAM]:
TGCCCAATCATAAAAAAGTCATGAC[C/T]GTCCCTATCTTGCCAATCTGCCAGG
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602750
MIM: 600437
|
||||||||||||||||||||
Literature Links: |
DDT PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| DDT - D-dopachrome tautomerase | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001084392.1 | Intron | NP_001077861.1 | ||||
| NM_001355.3 | Intron | NP_001346.1 | ||||
| DDTL - D-dopachrome tautomerase-like | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001084393.1 | Intron | NP_001077862.1 | ||||
| XM_011529816.2 | Intron | XP_011528118.1 | ||||
| GSTT2 - glutathione S-transferase theta 2 (gene/pseudogene) | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| LOC107985559 - uncharacterized LOC107985559 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
Back To Top