Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Pedidos
            • Productos y proyectos personalizados
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_167938641_10
          See other MIR4757 GT Assays ›
          SNP ID:
          rs138448676
          Gene
          MIR4757 OSR1
          Gene Name
          microRNA 4757
          odd-skipped related transciption factor 1
          Set Membership:
          -
          Chromosome Location:
          Chr.2: 19352348 - 19352348 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          CGTCTTGTGGACAGCGAGAGTCCTG[A/G]ACTGGCAGAATCCTTTCCCACACTC

          Assay ID C_167938641_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 608891

          Literature Links:

          MIR4757 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          MIR4757 - microRNA 4757
          There are no transcripts associated with this gene.
          OSR1 - odd-skipped related transciption factor 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_145260.2 1900 Missense Mutation TCC,TTC S,F 243 NP_660303.1
          XM_006711942.3 1900 Missense Mutation TCC,TTC S,F 243 XP_006712005.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          zinc finger transcription factor

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          urogenital system development
          ureteric bud development
          mesonephros development
          chondrocyte differentiation
          transcription, DNA-templated
          heart development
          gonad development
          positive regulation of gene expression
          cell differentiation
          positive regulation of bone mineralization
          negative regulation of epithelial cell differentiation
          embryonic forelimb morphogenesis
          embryonic hindlimb morphogenesis
          embryonic skeletal limb joint morphogenesis
          middle ear morphogenesis
          odontogenesis
          embryonic digit morphogenesis
          negative regulation of apoptotic process
          positive regulation of transcription from RNA polymerase II promoter
          intermediate mesoderm development
          pronephros development
          stem cell differentiation
          positive regulation of epithelial cell proliferation
          palate development
          embryonic skeletal joint morphogenesis
          cellular response to retinoic acid
          metanephric mesenchyme development
          cell proliferation involved in kidney development
          metanephric mesenchyme morphogenesis
          mesangial cell development
          metanephric mesenchymal cell differentiation
          posterior mesonephric tubule development
          specification of anterior mesonephric tubule identity
          specification of posterior mesonephric tubule identity
          mesonephric duct morphogenesis
          negative regulation of nephron tubule epithelial cell differentiation
          renal vesicle progenitor cell differentiation
          ureter urothelium development
          metanephric epithelium development
          metanephric smooth muscle tissue development
          metanephric nephron tubule development
          metanephric glomerulus vasculature development
          metanephric interstitial fibroblast development
          pattern specification involved in metanephros development
          embryonic skeletal joint development
          metanephric cap mesenchymal cell proliferation involved in metanephros development
          positive regulation of gastrulation
          nucleic acid binding
          metal ion binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Chile flag icon
          Chile

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-hznln:80/100.66.79.29:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline