Search Thermo Fisher Scientific
- Contact Us
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
ACCCGAACGTGGACGAGCACTTGTC[C/T]ACCCAGATTCTCGCGCCCTCGGTCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 615288 MIM: 607915 | ||||||||||||||||||||
Literature Links: |
DRC1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DRC1 - dynein regulatory complex subunit 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_145038.4 | 43 | Silent Mutation | TCC,TCT | S,S 19 | NP_659475.2 | |
XM_005264637.3 | 43 | UTR 5 | XP_005264694.1 | |||
XM_005264638.3 | 43 | Intron | XP_005264695.1 | |||
XM_017005271.1 | 43 | UTR 5 | XP_016860760.1 |
EPT1 - ethanolaminephosphotransferase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |