Search
LOADING 
- SNP ID:
- rs145708261
- Gene
-
ATG4BDTYMKING5 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.2: 241678500 - 241678500 on Build GRCh38
- Polymorphism:
- C/T, Transition substitution
- Context Sequence [VIC/FAM]:
TCATGAGCTGGTGGAAACACCGGAG[C/T]GCCCGCTCCTGGAAAGCCCCGTTCT
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611338
MIM: 188345
MIM: 608525
|
||||||||||||||||||||
Literature Links: |
ATG4B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| ATG4B - autophagy related 4B cysteine peptidase | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| DTYMK - deoxythymidylate kinase | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001165031.1 | 502 | Silent Mutation | NP_001158503.1 | |||
| NM_001320902.1 | 502 | Silent Mutation | NP_001307831.1 | |||
| NM_001320903.1 | 502 | Missense Mutation | NP_001307832.1 | |||
| NM_001320904.1 | 502 | Silent Mutation | NP_001307833.1 | |||
| NM_001320905.1 | 502 | Silent Mutation | NP_001307834.1 | |||
| NM_012145.3 | 502 | Silent Mutation | NP_036277.2 | |||
| ING5 - inhibitor of growth family member 5 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
Back To Top