Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_168838515_10
          See other AAMP GT Assays ›
          SNP ID:
          rs149837076
          Gene
          AAMP MIR6513 PNKD TMBIM1
          Gene Name
          angio associated migratory cell protein
          microRNA 6513
          paroxysmal nonkinesigenic dyskinesia
          transmembrane BAX inhibitor motif containing 1
          Set Membership:
          -
          Chromosome Location:
          Chr.2: 218275490 - 218275490 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          GGCTTGCTCCTTAATTGCGATCCCC[C/T]ATCAGCTGCAGCACAAAGGTGAAGA

          Assay ID C_168838515_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 603488 MIM: 609023 MIM: 610364

          Literature Links:

          AAMP PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          AAMP - angio associated migratory cell protein
          There are no transcripts associated with this gene.
          MIR6513 - microRNA 6513
          There are no transcripts associated with this gene.
          PNKD - paroxysmal nonkinesigenic dyskinesia
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001077399.2 998 Intron NP_001070867.1
          NM_015488.4 998 Intron NP_056303.3
          NM_022572.4 998 Intron NP_072094.1
          XM_017003771.1 998 Intron XP_016859260.1
          XM_017003772.1 998 Intron XP_016859261.1
          TMBIM1 - transmembrane BAX inhibitor motif containing 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001321427.1 998 Missense Mutation ATA,ATG I,M 307 NP_001308356.1
          NM_001321428.1 998 Missense Mutation ATA,ATG I,M 307 NP_001308357.1
          NM_001321429.1 998 Missense Mutation ATA,ATG I,M 307 NP_001308358.1
          NM_001321430.1 998 Missense Mutation ATA,ATG I,M 307 NP_001308359.1
          NM_001321432.1 998 Missense Mutation ATA,ATG I,M 307 NP_001308361.1
          NM_001321433.1 998 Missense Mutation ATA,ATG I,M 307 NP_001308362.1
          NM_001321435.1 998 Missense Mutation ATA,ATG I,M 307 NP_001308364.1
          NM_001321436.1 998 Missense Mutation ATA,ATG I,M 307 NP_001308365.1
          NM_001321438.1 998 Missense Mutation ATA,ATG I,M 196 NP_001308367.1
          NM_022152.5 998 Missense Mutation ATA,ATG I,M 307 NP_071435.2
          XM_011511627.1 998 Missense Mutation ATA,ATG I,M 307 XP_011509929.1

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          methylglyoxal catabolic process to D-lactate via S-lactoyl-glutathione
          regulation of synaptic transmission, dopaminergic
          regulation of dopamine metabolic process
          negative regulation of neurotransmitter secretion
          neuromuscular process controlling posture
          negative regulation of catalytic activity
          negative regulation of establishment of protein localization to plasma membrane
          negative regulation of extrinsic apoptotic signaling pathway via death domain receptors
          negative regulation of Fas signaling pathway
          positive regulation of blood vessel remodeling
          hydroxyacylglutathione hydrolase activity
          protein binding
          metal ion binding
          death receptor binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          • Social Media
          • Contact Us
          • Report a Site Issue
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Chile flag icon
          Chile

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline