Search
Search

HIST1H2AG
HIST1H2BJ
HIST1H2BK
HIST1H4ITCCGCAACGACGAGGAGCTCAACAA[C/G]CTGCTGGGCAAAGTCACCATCGCAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|
||||||||||||||||||||
Literature Links: |
HIST1H2AG PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| HIST1H2AG - histone cluster 1, H2ag | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_021064.4 | 322 | Silent Mutation | AAC,AAG | N,K 96 | NP_066408.1 | |
| HIST1H2BJ - histone cluster 1, H2bj | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_021058.3 | 322 | Intron | NP_066402.2 | |||
| HIST1H2BK - histone cluster 1, H2bk | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| HIST1H4I - histone cluster 1, H4i | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||