Search Thermo Fisher Scientific
- Contact Us
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
CAGCCGACAGCTCCCGGAAAGTGAC[A/G]CAGACGCGGCGGGCCTCGATGTGTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 613302 MIM: 615167 MIM: 610929 | ||||||||||||||||||||
Literature Links: |
ALKBH4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ALKBH4 - alkB homolog 4, lysine demethylase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_017621.3 | 839 | Silent Mutation | TGC,TGT | C,C 267 | NP_060091.1 | |
XM_005250464.2 | 839 | Silent Mutation | TGC,TGT | C,C 194 | XP_005250521.1 | |
XM_005250465.2 | 839 | Silent Mutation | TGC,TGT | C,C 129 | XP_005250522.1 |
LRWD1 - leucine rich repeats and WD repeat domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR5090 - microRNA 5090 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ORAI2 - ORAI calcium release-activated calcium modulator 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001126340.2 | 839 | Intron | NP_001119812.1 | |||
NM_001271818.1 | 839 | Intron | NP_001258747.1 | |||
NM_001271819.1 | 839 | Intron | NP_001258748.1 | |||
NM_032831.3 | 839 | Intron | NP_116220.1 |