Search
Search

ABCB8
ASIC3
CDK5
SLC4A2CATCCGCGTGTTCGCCAGCAACTGC[G/T]CGATGCACGGGCTGGGCCACGTCTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|
||||||||||||||||||||
Literature Links: |
ABCB8 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| ABCB8 - ATP binding cassette subfamily B member 8 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| ASIC3 - acid sensing ion channel subunit 3 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_004769.3 | 667 | Missense Mutation | GCG,TCG | A,S 25 | NP_004760.1 | |
| NM_020321.3 | 667 | Missense Mutation | GCG,TCG | A,S 25 | NP_064717.1 | |
| NM_020322.3 | 667 | Missense Mutation | GCG,TCG | A,S 25 | NP_064718.1 | |
| CDK5 - cyclin dependent kinase 5 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| SLC4A2 - solute carrier family 4 member 2 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||