Search Thermo Fisher Scientific
- Contact Us
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
GCGTGGGGCTCCCCTTCCGCTCAGG[A/G]TAAGCCGAGGTGGGGCTCCCTTTTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611927 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
FAM83H PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
FAM83H - family with sequence similarity 83 member H | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_198488.3 | 3890 | Silent Mutation | TAC,TAT | Y,Y 875 | NP_940890.3 | |
XM_005250887.3 | 3890 | Silent Mutation | TAC,TAT | Y,Y 894 | XP_005250944.1 | |
XM_005250888.3 | 3890 | Silent Mutation | TAC,TAT | Y,Y 881 | XP_005250945.1 | |
XM_005250889.3 | 3890 | Silent Mutation | TAC,TAT | Y,Y 875 | XP_005250946.1 | |
XM_011516980.2 | 3890 | Silent Mutation | TAC,TAT | Y,Y 1076 | XP_011515282.2 | |
XM_011516981.2 | 3890 | Silent Mutation | TAC,TAT | Y,Y 931 | XP_011515283.1 |
FAM83H-AS1 - FAM83H antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAPK15 - mitogen-activated protein kinase 15 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4664 - microRNA 4664 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |