Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Pipettes and Pipette Tips
    • Lab Centrifuges
    • Ultra-Low Temperature Freezers
    • Spectroscopy
    • Beakers
    • PCR Equipment and Supplies
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • See all product categories
  • Applications
    • Cell Analysis
    • Lab Equipment
    • Real-Time PCR
    • PCR
    • Chromatography
    • Cell Culture and Transfection
    • DNA and RNA Extraction and Analysis
    • Protein Biology
    • Flow Cytometry
    • Chemicals
    • See all applications and techniques
  • Services
    • Custom Services
    • Lab Informatics
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Instrument Services
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • Customer Center
    • Contact Us
    • Certificates of Analysis and Conformance
    • Safety Data Sheets (SDS)
    • Manuals
    • How to Cite Our Products in a Paper
    • Instrument Support
    • Knowledge Base and Product FAQs
    • Learning Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_175096821_10
          See other IFNB1 GT Assays ›
          SNP ID:
          rs149609099
          Gene
          IFNB1
          Gene Name
          interferon beta 1
          Set Membership:
          -
          Chromosome Location:
          Chr.9: 21077548 - 21077548 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          ATCTGATGATAGACATTAGCCAGGA[A/G]GTTCTCAACAATAGTCTCATTCCAG

          Assay ID C_175096821_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 147640

          Literature Links:

          IFNB1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          IFNB1 - interferon beta 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_002176.3 416 Missense Mutation CTC,TTC L,F 108 NP_002167.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          interferon superfamily

          Gene Ontology Categories:

          Function(s) Process(es)

          adaptive immune response
          T cell activation involved in immune response
          B cell activation involved in immune response
          natural killer cell activation involved in immune response
          humoral immune response
          cell surface receptor signaling pathway
          blood coagulation
          response to virus
          natural killer cell activation
          B cell differentiation
          positive regulation of peptidyl-serine phosphorylation of STAT protein
          cellular response to interferon-beta
          B cell proliferation
          defense response to bacterium
          response to exogenous dsRNA
          negative regulation of viral genome replication
          positive regulation of innate immune response
          regulation of MHC class I biosynthetic process
          negative regulation of T cell differentiation
          positive regulation of transcription from RNA polymerase II promoter
          defense response to virus
          type I interferon signaling pathway
          regulation of type I interferon-mediated signaling pathway
          cellular response to exogenous dsRNA
          cellular response to dexamethasone stimulus
          cellular response to virus
          negative regulation of T-helper 2 cell cytokine production
          positive regulation of apoptotic signaling pathway
          cytokine activity
          type I interferon receptor binding
          chloramphenicol O-acetyltransferase activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Fair Trade Fair Trade
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Korea flag icon
          Korea

          Customer Help Desk | working day 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          Service Call Center | working day 09:00~18:00
          1661-5055   |   Live Chat

          Customer Help Desk | working day 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          Service Call Center | working day 09:00~18:00
          1661-5055   |   Live Chat

          Customer Help Desk | working day 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          Service Call Center | working day 09:00~18:00
          1661-5055   |   Live Chat

          Thermo Fisher Scientific Korea Ltd.
          Representative : Soojin Seok
          Company Registration No. : 117-81-46910

           

          Thermo Fisher Scientific Solutions LLC
          Representative : Soojin Seok
          Company Registration No. : 114-86-04783

           

          Location: 12F Suseo Office Building, 281 Gwangpyeong-ro, Gangnam-gu, Seoul, Korea(06349) | Mail-Order Business Registration : 2015-Seoul Gangnam-00898 | Payment : ShinHan Bank 140-004-396660 (Thermo Fisher Scientific Solutions LLC)

          ISMS Logo

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-b2k9d:80/100.66.79.173:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline