Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_175144525_10
          See other PTCH1 GT Assays ›
          SNP ID:
          rs150696398
          Gene
          PTCH1
          Gene Name
          patched 1
          Set Membership:
          -
          Chromosome Location:
          Chr.9: 95446943 - 95446943 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          GGAGCTGCTTCCCCGGGGCCTCTCC[C/T]CGCATTCCACGTCCTGCAGCTCAAT

          Assay ID C_175144525_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 601309

          Literature Links:

          PTCH1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          PTCH1 - patched 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000264.3 4301 Missense Mutation GAG,GGG E,G 1438 NP_000255.2
          NM_001083602.1 4301 Missense Mutation GAG,GGG E,G 1372 NP_001077071.1
          NM_001083603.1 4301 Missense Mutation GAG,GGG E,G 1437 NP_001077072.1
          NM_001083604.1 4301 Missense Mutation GAG,GGG E,G 1287 NP_001077073.1
          NM_001083605.1 4301 Missense Mutation GAG,GGG E,G 1287 NP_001077074.1
          NM_001083606.1 4301 Missense Mutation GAG,GGG E,G 1287 NP_001077075.1
          NM_001083607.1 4301 Missense Mutation GAG,GGG E,G 1287 NP_001077076.1

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          branching involved in ureteric bud morphogenesis
          in utero embryonic development
          cell fate determination
          neural tube closure
          heart morphogenesis
          smoothened signaling pathway
          regulation of mitotic cell cycle
          brain development
          regulation of smoothened signaling pathway
          response to mechanical stimulus
          organ morphogenesis
          dorsal/ventral pattern formation
          epidermal cell fate specification
          response to chlorate
          positive regulation of cholesterol efflux
          protein processing
          spinal cord motor neuron differentiation
          neural tube patterning
          neural plate axis specification
          embryonic limb morphogenesis
          response to estradiol
          response to retinoic acid
          regulation of protein localization
          limb morphogenesis
          hindlimb morphogenesis
          negative regulation of multicellular organism growth
          response to drug
          glucose homeostasis
          negative regulation of sequence-specific DNA binding transcription factor activity
          keratinocyte proliferation
          positive regulation of epidermal cell differentiation
          negative regulation of osteoblast differentiation
          negative regulation of smoothened signaling pathway
          positive regulation of transcription, DNA-templated
          embryonic organ development
          negative regulation of epithelial cell proliferation
          negative regulation of cell division
          pharyngeal system development
          mammary gland duct morphogenesis
          mammary gland epithelial cell differentiation
          smoothened signaling pathway involved in dorsal/ventral neural tube patterning
          cell differentiation involved in kidney development
          somite development
          cellular response to cholesterol
          renal system development
          cell proliferation involved in metanephros development
          protein targeting to plasma membrane
          patched binding
          smoothened binding
          protein binding
          hedgehog receptor activity
          heparin binding
          cholesterol binding
          cyclin binding
          protein complex binding
          hedgehog family protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          • Social Media
          • Contact Us
          • Report a Site Issue
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Chile flag icon
          Chile

          Your items have has been added!


          Host server : magellan-search-green-7d94cb4b65-6wvps:80/100.66.75.98:80.
          git-commit: c9e08c96761173abe34e68f880379696776a4827
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.44.1-2026.02.97.1.0