Search Thermo Fisher Scientific
- Contáctenos
- Orden Rápida
-
¿No tiene una cuenta? Crear una cuenta
Search Thermo Fisher Scientific
GGGCTGCTGGGCTGAGCAAGACGGG[C/T]GCTCCTCTCCATCACTTCCCTCAGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 300093 MIM: 300769 | ||||||||||||||||||||
Literature Links: |
GABRE PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GABRE - gamma-aminobutyric acid type A receptor epsilon subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004961.3 | 697 | Missense Mutation | CAC,CGC | H,R 420 | NP_004952.2 | |
XM_011531140.2 | 697 | Missense Mutation | CAC,CGC | H,R 198 | XP_011529442.1 | |
XM_017029386.1 | 697 | Missense Mutation | CAC,CGC | H,R 307 | XP_016884875.1 | |
XM_017029387.1 | 697 | Missense Mutation | CAC,CGC | H,R 275 | XP_016884876.1 | |
XM_017029388.1 | 697 | Missense Mutation | CAC,CGC | H,R 227 | XP_016884877.1 | |
XM_017029389.1 | 697 | UTR 3 | XP_016884878.1 |
MIR224 - microRNA 224 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR452 - microRNA 452 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |