Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Western Blot Products
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Food and Beverage
    • Lab Solutions
    • Pharma and Biopharma
    • Real-Time PCR
    • Semiconductor Analysis
    • Clinical and Diagnostics
    • Digital Solutions
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Enterprise Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • See all services
  • Help and Support
    • Order Help
    • Digital Solutions
    • Product Support
    • Technical Information
    • Training and Education
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Special Offers
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_183067131_10
          See other OR7E18P GT Assays ›
          SNP ID:
          rs187404486
          Gene
          OR7E18P OR7E24
          Gene Name
          olfactory receptor family 7 subfamily E member 18 pseudogene
          olfactory receptor family 7 subfamily E member 24
          Set Membership:
          -
          Chromosome Location:
          Chr.19: 9251046 - 9251046 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          CAGTGCTAGATGCTGGTTTACTTAT[A/G]TCCTATTTTCCAATTCTCTTTTTTT

          Assay ID C_183067131_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          Literature Links:

          OR7E18P PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          A (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          A (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          A (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          A (0.00)
          (1.00)
          AMR
          A (0.00)
          (1.00)
          OR7E18P - olfactory receptor family 7 subfamily E member 18 pseudogene
          There are no transcripts associated with this gene.
          OR7E24 - olfactory receptor family 7 subfamily E member 24
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001079935.1 Intron NP_001073404.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          transmembrane signal receptor

          Gene Ontology Categories:

          Function(s) Process(es)

          G-protein coupled receptor signaling pathway
          detection of chemical stimulus involved in sensory perception of smell
          G-protein coupled receptor activity
          olfactory receptor activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Taiwan flag icon
          Taiwan

          Your items have has been added!


          Host server : magellan-search-blue-55ff9ddd88-b6zsg:80/100.66.76.158:80.
          git-commit: d366ff9721d93504b2ac26a183b2b3e3d0e7d9ec
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.42.0-2026.01.03-1.0