Hamburger Menu Button
Thermo Fisher Scientific Logo
로그인
회원이 아니신가요? 계정 생성하기
  • 모든 제품 주문
    • 항체
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR 분석
    • 피펫 및 피펫 팁
    • 실험실용 원심분리기
    • 초저온 냉동고
    • 분광학
    • 비이커
    • PCR 장비 및 용품
    • 제품 카테고리 전체보기
  • 응용 분야 및 기법
    • 세포 분석
    • 실험실 장비
    • Real-Time PCR
    • PCR
    • 크로마토그래피
    • 세포 배양 및 트랜스펙션
    • DNA/RNA 추출과 분석
    • 단백질 생물학
    • 유세포분석
    • 화학 제품
    • 응용 분야 및 기법 전체보기
  • 서비스
    • 맞춤형 서비스
    • 엔터프라이즈급 실험실 정보 처리
    • 360° CDMO 및 CRO 서비스
    • CDMO 서비스
    • 임상시험 CRO 서비스
    • 장비 서비스
    • 교육 서비스
    • Unity Lab Services
    • 서비스 전체 보기
  • 지원
    • 고객센터
    • 문의하기
    • 시험성적서(COA) 및 적합성 인증서(COC)
    • Safety Data Sheets (SDS)
    • 매뉴얼
    • 인용 및 참고 문헌
    • 기기 지원
    • 기술 자료/제품 FAQ
    • 학습 센터
    • 지원 메뉴 전체보기
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • 문의하기
  • 빠른 주문
  • 주문 현황
  • 제품 문서 검색
Thermo Fisher Scientific Logo

Search

전체검색
Search button
          • 주문 현황
          • 빠른주문
          • 로그인
            로그인
            회원이 아니신가요? 계정 생성하기
            • 계정정보
            • 주문내역조회
            • 커스텀제품 및 프로젝트
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_189586726_10
          See other SNCA GT Assays ›
          SNP ID:
          rs986610
          Gene
          SNCA SNCA-AS1
          Gene Name
          synuclein alpha
          SNCA antisense RNA 1
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.4: 89830504 - 89830504 on Build GRCh38
          Polymorphism:
          T/C, Transition substitution
          Context Sequence [VIC/FAM]:

          ATTACCCTAATTTGATTATCACACA[T/C]TGTATACATGTATGGAAATATAATT

          Assay ID C_189586726_10
          Size
          재고 정보 주문접수 후 제작
          Catalog # 4351379
          제품 정가
          Your Price
          온라인 행사가:
          공급가 확인 ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay 상세 정보



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 163890

          Literature Links:

          SNCA PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.11)
          (0.89)
          Caucasian - Not Available CEPH (CEU)
          C (0.31)
          (0.69)
          EAS
          C (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba)
          C (0.03)
          (0.97)
          SAS
          C (0.09)
          (0.91)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          C (0.03)
          (0.97)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          C (0.30)
          (0.70)
          AMR
          C (0.15)
          (0.85)
          SNCA - synuclein alpha
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000345.3 Intron NP_000336.1
          NM_001146054.1 Intron NP_001139526.1
          NM_001146055.1 Intron NP_001139527.1
          NM_007308.2 Intron NP_009292.1
          XM_011532203.1 Intron XP_011530505.1
          XM_011532204.2 Intron XP_011530506.1
          XM_011532205.2 Intron XP_011530507.1
          XM_011532206.1 Intron XP_011530508.1
          XM_011532207.1 Intron XP_011530509.1
          XM_011532208.2 Intron XP_011530510.1
          XM_017008562.1 Intron XP_016864051.1
          XM_017008563.1 Intron XP_016864052.1
          SNCA-AS1 - SNCA antisense RNA 1
          There are no transcripts associated with this gene.

          Back To Top

          추가 정보


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          membrane trafficking regulatory protein

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          microglial cell activation
          positive regulation of receptor recycling
          negative regulation of protein phosphorylation
          positive regulation of neurotransmitter secretion
          fatty acid metabolic process
          neutral lipid metabolic process
          phospholipid metabolic process
          apoptotic process
          activation of cysteine-type endopeptidase activity involved in apoptotic process
          mitochondrial membrane organization
          aging
          adult locomotory behavior
          response to iron(II) ion
          regulation of phospholipase activity
          negative regulation of platelet-derived growth factor receptor signaling pathway
          regulation of glutamate secretion
          regulation of dopamine secretion
          negative regulation of microtubule polymerization
          receptor internalization
          protein destabilization
          response to magnesium ion
          negative regulation of transporter activity
          response to lipopolysaccharide
          negative regulation of monooxygenase activity
          positive regulation of peptidyl-serine phosphorylation
          response to interferon-gamma
          cellular response to oxidative stress
          negative regulation of histone acetylation
          regulation of locomotion
          dopamine biosynthetic process
          response to drug
          mitochondrial ATP synthesis coupled electron transport
          regulation of macrophage activation
          positive regulation of apoptotic process
          negative regulation of apoptotic process
          negative regulation of cysteine-type endopeptidase activity involved in apoptotic process
          extracellular fibril organization
          negative regulation of neuron apoptotic process
          cellular protein metabolic process
          cellular response to fibroblast growth factor stimulus
          positive regulation of endocytosis
          negative regulation of exocytosis
          negative regulation of dopamine metabolic process
          behavioral response to cocaine
          regulation of long-term neuronal synaptic plasticity
          synaptic vesicle endocytosis
          synapse organization
          regulation of acyl-CoA biosynthetic process
          positive regulation of release of sequestered calcium ion into cytosol
          dopamine uptake involved in synaptic transmission
          negative regulation of dopamine uptake involved in synaptic transmission
          negative regulation of serotonin uptake
          negative regulation of norepinephrine uptake
          calcium ion homeostasis
          oxidation-reduction process
          excitatory postsynaptic potential
          long-term synaptic potentiation
          positive regulation of inositol phosphate biosynthetic process
          negative regulation of thrombin receptor signaling pathway
          response to interleukin-1
          cellular response to copper ion
          cellular response to epinephrine stimulus
          positive regulation of protein serine/threonine kinase activity
          negative regulation of neuron death
          negative regulation of mitochondrial electron transport, NADH to ubiquinone
          positive regulation of glutathione peroxidase activity
          positive regulation of hydrogen peroxide catabolic process
          regulation of synaptic vesicle recycling
          regulation of reactive oxygen species biosynthetic process
          negative regulation of chaperone-mediated autophagy
          magnesium ion binding
          fatty acid binding
          copper ion binding
          calcium ion binding
          protein binding
          phospholipid binding
          microtubule binding
          ferrous iron binding
          zinc ion binding
          oxidoreductase activity
          kinesin binding
          protein domain specific binding
          histone binding
          identical protein binding
          alpha-tubulin binding
          cysteine-type endopeptidase inhibitor activity involved in apoptotic process
          phospholipase binding
          transcription regulatory region DNA binding
          dynein binding
          protein N-terminus binding
          tau protein binding
          beta-tubulin binding
          phosphoprotein binding
          phospholipase D inhibitor activity

          Back To Top

          관련 제품

          • TaqMan® Genotyping Master Mix
          온라인 주문 Plus Icon Minus Icon
          • 주문 현황
          • 주문 지원
          • 빠른 주문
          • Supply Center
          • eProcurement
          지원 Plus Icon Minus Icon
          • Help and Support
          • 고객 센터
          • 기술 지원 센터
          • 제품 문서 검색
          • 사이트 문제 보고
          교육 및 이벤트 Plus Icon Minus Icon
          • 교육 센터
          • 프로모션
          • 이벤트 및 웨비나
          • 소셜 미디어
          About Thermo Fisher Plus Icon Minus Icon
          • 소개 소개
          • 채용 채용
          • 투자자 투자자
          • 뉴스 뉴스
          • 사회적 책임 사회적 책임
          • Trademarks
          • 공정거래 공정거래
          • 정책 및 고지
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • 이용 약관
          • 개인정보 처리방침
          • 가격 및 운임 정책
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Korea flag icon
          Korea

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          써모 피셔 사이언티픽 코리아 주식회사
          대표자 : 석수진
          사업자 등록번호 : 117-81-46910
          입금계좌 : 하나은행 336-890014-06204
          (예금주 : 써모피셔사이언티픽코리아 주식회사)

           

          써모 피셔 사이언티픽 솔루션스 유한회사
          대표자 : 석수진
          사업자 등록번호 : 114-86-04783
          입금계좌 : 신한은행 140-004-396660
          (예금주 : 써모피셔사이언티픽솔루션스 유한회사)

           

          주소 : 서울시 강남구 광평로 281 수서오피스빌딩 12층 06349 | 통신판매업신고번호 : 2015-서울강남-00898

          ISMS Logo

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-h9fps:80/100.66.77.141:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline