Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_189624465_10
          See other PPP3CB GT Assays ›
          SNP ID:
          rs200513165
          Gene
          PPP3CB PPP3CB-AS1 USP54
          Gene Name
          protein phosphatase 3 catalytic subunit beta
          PPP3CB antisense RNA 1 (head to head)
          ubiquitin specific peptidase 54
          Set Membership:
          -
          Chromosome Location:
          Chr.10: 73498884 - 73498884 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          TGCTAGATGGTGGGTACACAGGATG[A/G]ACAATGGGAGGGTGGGAGGGTGAAT

          Assay ID C_189624465_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 114106

          Literature Links:

          PPP3CB PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          G (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          G (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          G (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          G (0.00)
          (1.00)
          AMR
          G (0.00)
          (1.00)
          PPP3CB - protein phosphatase 3 catalytic subunit beta
          There are no transcripts associated with this gene.
          PPP3CB-AS1 - PPP3CB antisense RNA 1 (head to head)
          There are no transcripts associated with this gene.
          USP54 - ubiquitin specific peptidase 54
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001320437.1 4704 Silent Mutation GTC,GTT V,V 1538 NP_001307366.1
          NM_001320441.1 4704 Intron NP_001307370.1
          NM_152586.3 4704 Silent Mutation GTC,GTT V,V 1600 NP_689799.3
          XM_005269582.2 4704 Silent Mutation GTC,GTT V,V 1496 XP_005269639.1
          XM_011539368.2 4704 Silent Mutation GTC,GTT V,V 1565 XP_011537670.1
          XM_017015759.1 4704 Silent Mutation GTC,GTT V,V 1624 XP_016871248.1
          XM_017015760.1 4704 Silent Mutation GTC,GTT V,V 1624 XP_016871249.1
          XM_017015761.1 4704 Silent Mutation GTC,GTT V,V 1624 XP_016871250.1
          XM_017015762.1 4704 Silent Mutation GTC,GTT V,V 1624 XP_016871251.1
          XM_017015763.1 4704 Silent Mutation GTC,GTT V,V 1624 XP_016871252.1
          XM_017015764.1 4704 Silent Mutation GTC,GTT V,V 1624 XP_016871253.1
          XM_017015765.1 4704 Silent Mutation GTC,GTT V,V 1624 XP_016871254.1
          XM_017015766.1 4704 Silent Mutation GTC,GTT V,V 1624 XP_016871255.1
          XM_017015767.1 4704 Silent Mutation GTC,GTT V,V 1624 XP_016871256.1
          XM_017015768.1 4704 Silent Mutation GTC,GTT V,V 1624 XP_016871257.1
          XM_017015769.1 4704 Silent Mutation GTC,GTT V,V 1624 XP_016871258.1
          XM_017015770.1 4704 Silent Mutation GTC,GTT V,V 1624 XP_016871259.1
          XM_017015771.1 4704 Silent Mutation GTC,GTT V,V 1622 XP_016871260.1
          XM_017015772.1 4704 Silent Mutation GTC,GTT V,V 1619 XP_016871261.1
          XM_017015773.1 4704 Silent Mutation GTC,GTT V,V 1602 XP_016871262.1
          XM_017015774.1 4704 Silent Mutation GTC,GTT V,V 1600 XP_016871263.1
          XM_017015775.1 4704 Silent Mutation GTC,GTT V,V 1600 XP_016871264.1
          XM_017015776.1 4704 Silent Mutation GTC,GTT V,V 1600 XP_016871265.1
          XM_017015777.1 4704 Silent Mutation GTC,GTT V,V 1600 XP_016871266.1
          XM_017015778.1 4704 Silent Mutation GTC,GTT V,V 1584 XP_016871267.1
          XM_017015779.1 4704 Silent Mutation GTC,GTT V,V 1577 XP_016871268.1
          XM_017015780.1 4704 Silent Mutation GTC,GTT V,V 1572 XP_016871269.1
          XM_017015781.1 4704 Silent Mutation GTC,GTT V,V 1567 XP_016871270.1
          XM_017015782.1 4704 Silent Mutation GTC,GTT V,V 1560 XP_016871271.1
          XM_017015783.1 4704 Silent Mutation GTC,GTT V,V 1543 XP_016871272.1
          XM_017015784.1 4704 Silent Mutation GTC,GTT V,V 1543 XP_016871273.1
          XM_017015785.1 4704 Silent Mutation GTC,GTT V,V 1537 XP_016871274.1
          XM_017015786.1 4704 Silent Mutation GTC,GTT V,V 1503 XP_016871275.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          cysteine protease

          Gene Ontology Categories:

          Function(s) Process(es)

          protein deubiquitination
          protein binding
          thiol-dependent ubiquitinyl hydrolase activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-x75fr:80/100.66.77.4:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline