Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_189719712_10
          See other GSTP1 GT Assays ›
          SNP ID:
          rs200701643
          Gene
          GSTP1
          Gene Name
          glutathione S-transferase pi 1
          Set Membership:
          -
          Chromosome Location:
          Chr.11: 67584721 - 67584721 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          GCTCCCCAAGTTCCAGGACGGAGAC[C/T]TCACCCTGTACCAGTCCAATACCAT

          Assay ID C_189719712_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 134660

          Literature Links:

          GSTP1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          GSTP1 - glutathione S-transferase pi 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000852.3 430 Missense Mutation CTC,TTC L,F 61 NP_000843.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          transferase

          Gene Ontology Categories:

          Function(s) Process(es)

          response to reactive oxygen species
          negative regulation of acute inflammatory response
          negative regulation of protein kinase activity
          glutathione metabolic process
          xenobiotic metabolic process
          central nervous system development
          negative regulation of biosynthetic process
          negative regulation of tumor necrosis factor-mediated signaling pathway
          oligodendrocyte development
          organ regeneration
          response to estradiol
          negative regulation of interleukin-1 beta production
          negative regulation of tumor necrosis factor production
          cellular response to insulin stimulus
          regulation of stress-activated MAPK cascade
          negative regulation of stress-activated MAPK cascade
          positive regulation of superoxide anion generation
          response to L-ascorbic acid
          common myeloid progenitor cell proliferation
          nitric oxide storage
          negative regulation of apoptotic process
          negative regulation of I-kappaB kinase/NF-kappaB signaling
          response to amino acid
          negative regulation of MAP kinase activity
          negative regulation of MAPK cascade
          negative regulation of JUN kinase activity
          linoleic acid metabolic process
          response to ethanol
          response to mercury ion
          negative regulation of fibroblast proliferation
          negative regulation of nitric-oxide synthase biosynthetic process
          regulation of ERK1 and ERK2 cascade
          negative regulation of ERK1 and ERK2 cascade
          negative regulation of leukocyte proliferation
          cellular response to lipopolysaccharide
          cellular response to epidermal growth factor stimulus
          cellular response to glucocorticoid stimulus
          cellular response to cell-matrix adhesion
          negative regulation of monocyte chemotactic protein-1 production
          cellular oxidant detoxification
          glutathione derivative biosynthetic process
          negative regulation of extrinsic apoptotic signaling pathway
          glutathione transferase activity
          glutathione peroxidase activity
          protein binding
          drug binding
          JUN kinase binding
          kinase regulator activity
          S-nitrosoglutathione binding
          dinitrosyl-iron complex binding
          glutathione binding
          nitric oxide binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-zsnhf:80/100.66.75.14:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline