Search
Search

C11orf57
SDHD
TIMM8BGCGATGGACTATTCCCTGGCTGCAG[C/T]CCTCACTCTTCATGGTCACTGGCAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|
||||||||||||||||||||
Literature Links: |
C11orf57 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| C11orf57 - chromosome 11 open reading frame 57 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| SDHD - succinate dehydrogenase complex subunit D | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001276503.1 | Intron | NP_001263432.1 | ||||
| NM_001276504.1 | Intron | NP_001263433.1 | ||||
| NM_001276506.1 | Intron | NP_001263435.1 | ||||
| NM_003002.3 | Intron | NP_002993.1 | ||||
| TIMM8B - translocase of inner mitochondrial membrane 8 homolog B | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||