Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_189740686_10
          See other NRXN2 GT Assays ›
          SNP ID:
          rs200024020
          Gene
          NRXN2
          Gene Name
          neurexin 2
          Set Membership:
          -
          Chromosome Location:
          Chr.11: 64651517 - 64651517 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          TCCATGTAGGGCTGGCCATTGAACA[C/T]GAGCCCACTCAGATGCCCGATGAAG

          Assay ID C_189740686_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 600566

          Literature Links:

          NRXN2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          T (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          T (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          T (0.00)
          (1.00)
          AMR
          T (0.00)
          (1.00)
          NRXN2 - neurexin 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_015080.3 1016 Missense Mutation ATG,GTG M,V 886 NP_055895.1
          NM_138732.2 1016 Missense Mutation ATG,GTG M,V 846 NP_620060.1
          NM_138734.2 1016 Intron NP_620063.1
          XM_005274400.3 1016 Missense Mutation ATG,GTG M,V 879 XP_005274457.1
          XM_005274401.3 1016 Missense Mutation ATG,GTG M,V 879 XP_005274458.1
          XM_005274402.3 1016 Missense Mutation ATG,GTG M,V 871 XP_005274459.1
          XM_011545370.1 1016 Missense Mutation ATG,GTG M,V 889 XP_011543672.1
          XM_011545371.1 1016 Missense Mutation ATG,GTG M,V 888 XP_011543673.1
          XM_011545373.1 1016 Missense Mutation ATG,GTG M,V 882 XP_011543675.1
          XM_011545375.1 1016 Missense Mutation ATG,GTG M,V 874 XP_011543677.1
          XM_011545385.1 1016 Missense Mutation ATG,GTG M,V 151 XP_011543687.1
          XM_017018563.1 1016 Missense Mutation ATG,GTG M,V 879 XP_016874052.1
          XM_017018564.1 1016 Missense Mutation ATG,GTG M,V 878 XP_016874053.1
          XM_017018565.1 1016 Missense Mutation ATG,GTG M,V 877 XP_016874054.1
          XM_017018566.1 1016 Missense Mutation ATG,GTG M,V 865 XP_016874055.1
          XM_017018567.1 1016 Missense Mutation ATG,GTG M,V 889 XP_016874056.1
          XM_017018568.1 1016 Missense Mutation ATG,GTG M,V 886 XP_016874057.1
          XM_017018569.1 1016 Missense Mutation ATG,GTG M,V 855 XP_016874058.1
          XM_017018570.1 1016 Missense Mutation ATG,GTG M,V 889 XP_016874059.1
          XM_017018571.1 1016 Missense Mutation ATG,GTG M,V 886 XP_016874060.1
          XM_017018572.1 1016 Missense Mutation ATG,GTG M,V 654 XP_016874061.1
          XM_017018573.1 1016 Missense Mutation ATG,GTG M,V 877 XP_016874062.1
          XM_017018574.1 1016 Missense Mutation ATG,GTG M,V 644 XP_016874063.1
          XM_017018575.1 1016 Missense Mutation ATG,GTG M,V 643 XP_016874064.1
          XM_017018576.1 1016 Missense Mutation ATG,GTG M,V 470 XP_016874065.1
          XM_017018577.1 1016 Missense Mutation ATG,GTG M,V 148 XP_016874066.1
          XM_017018578.1 1016 Missense Mutation ATG,GTG M,V 886 XP_016874067.1

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          neuron cell-cell adhesion
          signal transduction
          chemical synaptic transmission
          neurotransmitter secretion
          synapse assembly
          adult behavior
          social behavior
          vocal learning
          vocalization behavior
          postsynaptic membrane assembly
          gephyrin clustering involved in postsynaptic density assembly
          neuroligin clustering involved in postsynaptic membrane assembly
          postsynaptic density protein 95 clustering
          transmembrane signaling receptor activity
          calcium channel regulator activity
          metal ion binding
          cell adhesion molecule binding
          neuroligin family protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline