Search Thermo Fisher Scientific
- Order Status
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
GGAGCCTTCTCTGCTCCCTGATAGC[C/T]CTGTGGGCCAGCTTCATGCCTCCCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605580 MIM: 600556 | ||||||||||||||||||||
Literature Links: |
IL23A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
IL23A - interleukin 23 subunit alpha | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_016584.2 | 711 | Missense Mutation | CCT,TCT | P,S 120 | NP_057668.1 | |
XM_011538477.2 | 711 | Missense Mutation | CCT,TCT | P,S 120 | XP_011536779.1 |
PAN2 - PAN2 poly(A) specific ribonuclease subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
STAT2 - signal transducer and activator of transcription 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |