Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Pedidos
            • Productos y proyectos personalizados
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_189922196_10
          See other CAPRIN2 GT Assays ›
          SNP ID:
          rs201802333
          Gene
          CAPRIN2
          Gene Name
          caprin family member 2
          Set Membership:
          -
          Chromosome Location:
          Chr.12: 30711604 - 30711604 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          TCGTGGACCACCAGATGTCCCTCCT[C/T]GCTTATAACACTGCTGGAAATTATC

          Assay ID C_189922196_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 610375

          Literature Links:

          CAPRIN2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          CAPRIN2 - caprin family member 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001002259.2 2660 Missense Mutation CAA,CGA Q,R 926 NP_001002259.1
          NM_001206856.2 2660 Missense Mutation CAA,CGA Q,R 870 NP_001193785.1
          NM_001319842.1 2660 Missense Mutation CAA,CGA Q,R 592 NP_001306771.1
          NM_001319843.1 2660 Missense Mutation CAA,CGA Q,R 925 NP_001306772.1
          NM_001319844.1 2660 Missense Mutation CAA,CGA Q,R 810 NP_001306773.1
          NM_001319845.1 2660 Missense Mutation CAA,CGA Q,R 845 NP_001306774.1
          NM_001319846.1 2660 Missense Mutation CAA,CGA Q,R 845 NP_001306775.1
          NM_023925.4 2660 Missense Mutation CAA,CGA Q,R 876 NP_076414.2
          NM_032156.4 2660 Missense Mutation CAA,CGA Q,R 925 NP_115532.3
          XM_006719138.3 2660 Missense Mutation CAA,CGA Q,R 905 XP_006719201.1
          XM_006719139.3 2660 Missense Mutation CAA,CGA Q,R 891 XP_006719202.1
          XM_006719140.3 2660 Missense Mutation CAA,CGA Q,R 890 XP_006719203.1
          XM_006719142.3 2660 Missense Mutation CAA,CGA Q,R 856 XP_006719205.1
          XM_006719144.3 2660 Missense Mutation CAA,CGA Q,R 842 XP_006719207.1
          XM_006719145.3 2660 Missense Mutation CAA,CGA Q,R 926 XP_006719208.1
          XM_006719146.3 2660 Missense Mutation CAA,CGA Q,R 926 XP_006719209.1
          XM_006719147.3 2660 Missense Mutation CAA,CGA Q,R 905 XP_006719210.1
          XM_017019851.1 2660 Missense Mutation CAA,CGA Q,R 870 XP_016875340.1
          XM_017019852.1 2660 Missense Mutation CAA,CGA Q,R 844 XP_016875341.1
          XM_017019853.1 2660 Missense Mutation CAA,CGA Q,R 844 XP_016875342.1
          XM_017019854.1 2660 Missense Mutation CAA,CGA Q,R 841 XP_016875343.1
          XM_017019855.1 2660 Missense Mutation CAA,CGA Q,R 824 XP_016875344.1
          XM_017019856.1 2660 Missense Mutation CAA,CGA Q,R 810 XP_016875345.1
          XM_017019857.1 2660 Missense Mutation CAA,CGA Q,R 809 XP_016875346.1
          XM_017019858.1 2660 Missense Mutation CAA,CGA Q,R 809 XP_016875347.1
          XM_017019859.1 2660 Missense Mutation CAA,CGA Q,R 761 XP_016875348.1
          XM_017019860.1 2660 Missense Mutation AAG,GAG K,E 941 XP_016875349.1
          XM_017019861.1 2660 Missense Mutation CAA,CGA Q,R 760 XP_016875350.1
          XM_017019862.1 2660 Missense Mutation AAG,GAG K,E 940 XP_016875351.1
          XM_017019863.1 2660 Missense Mutation AAG,GAG K,E 941 XP_016875352.1
          XM_017019864.1 2660 Missense Mutation AAG,GAG K,E 941 XP_016875353.1
          XM_017019865.1 2660 Missense Mutation CAA,CGA Q,R 891 XP_016875354.1
          XM_017019866.1 2660 Missense Mutation CAA,CGA Q,R 845 XP_016875355.1
          XM_017019867.1 2660 Missense Mutation CAA,CGA Q,R 845 XP_016875356.1
          XM_017019868.1 2660 Missense Mutation CAA,CGA Q,R 844 XP_016875357.1
          XM_017019869.1 2660 Missense Mutation CAA,CGA Q,R 844 XP_016875358.1
          XM_017019870.1 2660 Missense Mutation CAA,CGA Q,R 824 XP_016875359.1
          XM_017019871.1 2660 Missense Mutation CAA,CGA Q,R 824 XP_016875360.1
          XM_017019872.1 2660 Missense Mutation CAA,CGA Q,R 789 XP_016875361.1
          XM_017019873.1 2660 Missense Mutation CAA,CGA Q,R 761 XP_016875362.1
          XM_017019874.1 2660 Missense Mutation CAA,CGA Q,R 592 XP_016875363.1
          XM_017019875.1 2660 Missense Mutation CAA,CGA Q,R 740 XP_016875364.1
          XM_017019876.1 2660 Missense Mutation CAA,CGA Q,R 572 XP_016875365.1
          XM_017019877.1 2660 Missense Mutation CAA,CGA Q,R 558 XP_016875366.1
          XM_017019878.1 2660 Missense Mutation CAA,CGA Q,R 557 XP_016875367.1
          XM_017019879.1 2660 Missense Mutation CAA,CGA Q,R 537 XP_016875368.1
          XM_017019880.1 2660 Missense Mutation CAA,CGA Q,R 488 XP_016875369.1
          XM_017019881.1 2660 Missense Mutation CAA,CGA Q,R 592 XP_016875370.1
          XM_017019882.1 2660 Missense Mutation CAA,CGA Q,R 572 XP_016875371.1
          XM_017019883.1 2660 Missense Mutation CAA,CGA Q,R 558 XP_016875372.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          RNA metabolism protein

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of translation
          negative regulation of cell growth
          positive regulation of protein binding
          positive regulation of peptidyl-serine phosphorylation
          positive regulation of transcription from RNA polymerase II promoter
          positive regulation of dendrite morphogenesis
          positive regulation of dendritic spine morphogenesis
          positive regulation of canonical Wnt signaling pathway
          RNA binding
          receptor binding
          protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Chile flag icon
          Chile

          Your items have has been added!


          Host server : magellan-search-green-7b6576f7bc-knt4q:80/100.66.75.14:80.
          git-commit: 6d309ebe7a31b2ceadeb87f43b473eebab110cf3
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-2026.03.11-1.0