Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_189952006_10
          See other SENP1 GT Assays ›
          SNP ID:
          rs201344041
          Gene
          SENP1
          Gene Name
          SUMO1/sentrin specific peptidase 1
          Set Membership:
          -
          Chromosome Location:
          Chr.12: 48045358 - 48045358 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          TTCGGTGGAGGATCTCCCAGACCAT[C/T]CGCTTCCGGAAGTATGGCATGTGTT

          Assay ID C_189952006_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 612157

          Literature Links:

          SENP1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          SENP1 - SUMO1/sentrin specific peptidase 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001267594.1 2475 Silent Mutation CGA,CGG R,R 633 NP_001254523.1
          NM_001267595.1 2475 Silent Mutation CGA,CGG R,R 633 NP_001254524.1
          XM_006719361.3 2475 Silent Mutation CGA,CGG R,R 665 XP_006719424.1
          XM_006719362.2 2475 Silent Mutation CGA,CGG R,R 434 XP_006719425.1
          XM_011538244.2 2475 Silent Mutation CGA,CGG R,R 652 XP_011536546.1
          XM_011538245.2 2475 Silent Mutation CGA,CGG R,R 649 XP_011536547.1
          XM_017019229.1 2475 Silent Mutation CGA,CGG R,R 696 XP_016874718.1
          XM_017019230.1 2475 Silent Mutation CGA,CGG R,R 683 XP_016874719.1
          XM_017019231.1 2475 Silent Mutation CGA,CGG R,R 664 XP_016874720.1
          XM_017019232.1 2475 Silent Mutation CGA,CGG R,R 664 XP_016874721.1
          XM_017019233.1 2475 Silent Mutation CGA,CGG R,R 626 XP_016874722.1
          XM_017019234.1 2475 Silent Mutation CGA,CGG R,R 626 XP_016874723.1
          XM_017019235.1 2475 Silent Mutation CGA,CGG R,R 626 XP_016874724.1
          XM_017019236.1 2475 Silent Mutation CGA,CGG R,R 620 XP_016874725.1
          XM_017019237.1 2475 Silent Mutation CGA,CGG R,R 620 XP_016874726.1
          XM_017019238.1 2475 Silent Mutation CGA,CGG R,R 434 XP_016874727.1
          XM_017019239.1 2475 Silent Mutation CGA,CGG R,R 434 XP_016874728.1
          XM_017019240.1 2475 Silent Mutation CGA,CGG R,R 421 XP_016874729.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          protease

          Gene Ontology Categories:

          Function(s) Process(es)

          proteolysis
          activation of cysteine-type endopeptidase activity involved in apoptotic process
          regulation of definitive erythrocyte differentiation
          protein sumoylation
          protein desumoylation
          negative regulation of proteasomal ubiquitin-dependent protein catabolic process
          positive regulation of transcription from RNA polymerase II promoter
          apoptotic signaling pathway
          endopeptidase activity
          protein binding
          SUMO-specific protease activity
          SUMO-specific endopeptidase activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-fkn7b:80/100.66.79.246:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline