Search Thermo Fisher Scientific
GTGCCAGCTCCTCTTTGCCCTCAAG[G/T]TGCTCAACATGATGCCCGAGGAGAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607559 | ||||||||||||||||||||
Literature Links: |
ANKS3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ANKS3 - ankyrin repeat and sterile alpha motif domain containing 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MGRN1 - mahogunin ring finger 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NUDT16L1 - nudix hydrolase 16 like 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001193452.1 | 639 | UTR 3 | NP_001180381.1 | |||
NM_032349.3 | 639 | Missense Mutation | GTG,TTG | V,L 179 | NP_115725.1 | |
XM_005255633.4 | 639 | UTR 3 | XP_005255690.1 |