Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Pedidos
            • Productos y proyectos personalizados
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_190500952_10
          See other LILRB1 GT Assays ›
          SNP ID:
          rs201209520
          Gene
          LILRB1
          Gene Name
          leukocyte immunoglobulin like receptor B1
          Set Membership:
          -
          Chromosome Location:
          Chr.19: 54631500 - 54631500 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          AATCTGACTCCTGATTTCCTTCCAG[A/G]GCACCTCCCCAAGCCCACCCTCTGG

          Assay ID C_190500952_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 604811

          Literature Links:

          LILRB1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          LILRB1 - leukocyte immunoglobulin like receptor B1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001081637.2 342 Intron NP_001075106.2
          NM_001081638.3 342 Missense Mutation GAG,GGG E,G 24 NP_001075107.2
          NM_001081639.3 342 Missense Mutation GAG,GGG E,G 24 NP_001075108.2
          NM_001278398.2 342 Intron NP_001265327.2
          NM_001278399.2 342 Missense Mutation GAG,GGG E,G 24 NP_001265328.2
          NM_006669.6 342 Missense Mutation GAG,GGG E,G 24 NP_006660.4
          XM_011526331.2 342 Intron XP_011524633.1
          XM_011526332.2 342 Intron XP_011524634.1
          XM_011526335.2 342 Intron XP_011524637.1
          XM_011526336.2 342 Intron XP_011524638.1
          XM_011526338.2 342 Intron XP_011524640.1
          XM_017026182.1 342 Intron XP_016881671.1
          XM_017026183.1 342 Intron XP_016881672.1
          XM_017026184.1 342 Intron XP_016881673.1
          XM_017026185.1 342 Intron XP_016881674.1
          XM_017026186.1 342 Intron XP_016881675.1
          XM_017026187.1 342 Missense Mutation GAG,GGG E,G 41 XP_016881676.1
          XM_017026188.1 342 Missense Mutation GAG,GGG E,G 41 XP_016881677.1
          XM_017026189.1 342 Missense Mutation GAG,GGG E,G 41 XP_016881678.1
          XM_017026190.1 342 Missense Mutation GAG,GGG E,G 41 XP_016881679.1
          XM_017026191.1 342 Intron XP_016881680.1
          XM_017026192.1 342 Intron XP_016881681.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          immunoglobulin receptor superfamily

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of T cell mediated cytotoxicity
          positive regulation of defense response to virus by host
          adaptive immune response
          T cell proliferation involved in immune response
          negative regulation of cytokine secretion involved in immune response
          immune response-inhibiting cell surface receptor signaling pathway
          Fc receptor mediated inhibitory signaling pathway
          signal transduction
          response to virus
          positive regulation of gene expression
          negative regulation of serotonin secretion
          receptor internalization
          interferon-gamma production
          negative regulation of interferon-gamma production
          negative regulation of mononuclear cell proliferation
          negative regulation of interferon-beta secretion
          negative regulation of T cell proliferation
          negative regulation of tumor necrosis factor biosynthetic process
          positive regulation of apoptotic process
          negative regulation of interferon-gamma biosynthetic process
          negative regulation of cell cycle
          negative regulation of endocytosis
          positive regulation of cytolysis
          positive regulation of transcription from RNA polymerase II promoter
          negative regulation of natural killer cell mediated cytotoxicity
          negative regulation of alpha-beta T cell activation
          regulation of immune response
          defense response to virus
          negative regulation of calcium ion transport
          cellular response to lipopolysaccharide
          interferon-gamma secretion
          dendritic cell differentiation
          negative regulation of dendritic cell apoptotic process
          negative regulation of interleukin-10 secretion
          negative regulation of interleukin-12 secretion
          negative regulation of CD8-positive, alpha-beta T cell activation
          negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell
          positive regulation of gamma-delta T cell activation involved in immune response
          negative regulation of dendritic cell differentiation
          negative regulation of transforming growth factor-beta secretion
          negative regulation of osteoclast development
          protein phosphatase 1 binding
          HLA-A specific inhibitory MHC class I receptor activity
          HLA-B specific inhibitory MHC class I receptor activity
          MHC class I receptor activity
          SH2 domain binding
          MHC class I protein binding
          protein homodimerization activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Chile flag icon
          Chile

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-x75fr:80/100.66.77.4:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline