Search Thermo Fisher Scientific
- Contact Us
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
CGGTACGGGGTGGAGCCACTGTGGA[A/G]GGCATCAGACTACGTGCCCTCCCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603619 | ||||||||||||||||||||
Literature Links: |
C19orf71 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C19orf71 - chromosome 19 open reading frame 71 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001135580.1 | 509 | Missense Mutation | AAG,AGG | K,R 163 | NP_001129052.1 | |
XM_011527596.2 | 509 | Missense Mutation | AAG,AGG | K,R 110 | XP_011525898.1 |
FZR1 - fizzy/cell division cycle 20 related 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MFSD12 - major facilitator superfamily domain containing 12 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001287529.1 | 509 | Intron | NP_001274458.1 | |||
NM_174983.4 | 509 | Intron | NP_778148.2 | |||
XM_005259490.4 | 509 | Intron | XP_005259547.1 | |||
XM_006722647.3 | 509 | Intron | XP_006722710.1 | |||
XM_011527684.2 | 509 | Intron | XP_011525986.1 | |||
XM_017026288.1 | 509 | Intron | XP_016881777.1 |