Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Pedidos
            • Productos y proyectos personalizados
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_190517164_10
          See other ICAM1 GT Assays ›
          SNP ID:
          rs200843423
          Gene
          ICAM1 ICAM4 ICAM5
          Gene Name
          intercellular adhesion molecule 1
          intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)
          intercellular adhesion molecule 5
          Set Membership:
          -
          Chromosome Location:
          Chr.19: 10287020 - 10287020 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          TAGTCCGGGCTTTTTGCCATGGGGT[C/T]TCTGTTCCCTCTGTCGCTGCTGTTT

          Assay ID C_190517164_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 147840 MIM: 614088 MIM: 601852

          Literature Links:

          ICAM1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          T (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          T (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          T (0.00)
          (1.00)
          AMR
          T (0.00)
          (1.00)
          ICAM1 - intercellular adhesion molecule 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000201.2 54 Intron NP_000192.2
          ICAM4 - intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001039132.2 54 Missense Mutation TCT,TTT S,F 3 NP_001034221.1
          NM_001544.4 54 Missense Mutation TCT,TTT S,F 3 NP_001535.1
          NM_022377.3 54 Missense Mutation TCT,TTT S,F 3 NP_071772.1
          ICAM5 - intercellular adhesion molecule 5
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          ovarian follicle development
          regulation of leukocyte mediated cytotoxicity
          response to amphetamine
          T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell
          acute inflammatory response to antigenic stimulus
          T cell antigen processing and presentation
          positive regulation of cellular extravasation
          cell adhesion
          heterophilic cell-cell adhesion via plasma membrane cell adhesion molecules
          leukocyte cell-cell adhesion
          cell aging
          sensory perception of sound
          regulation of cell shape
          response to ionizing radiation
          response to sulfur dioxide
          response to organic cyclic compound
          membrane to membrane docking
          regulation of cell adhesion
          extracellular matrix organization
          positive regulation of actin filament polymerization
          cellular response to nutrient levels
          cell adhesion mediated by integrin
          response to gonadotropin
          response to drug
          response to amino acid
          positive regulation of GTPase activity
          adhesion of symbiont to host
          positive regulation of nitric oxide biosynthetic process
          response to ethanol
          positive regulation of vasoconstriction
          response to copper ion
          viral entry into host cell
          receptor-mediated virion attachment to host cell
          positive regulation of peptidyl-tyrosine phosphorylation
          regulation of immune response
          leukocyte migration
          positive regulation of NF-kappaB transcription factor activity
          negative regulation of calcium ion transport
          interferon-gamma-mediated signaling pathway
          establishment of endothelial barrier
          positive regulation of ERK1 and ERK2 cascade
          cellular response to lipopolysaccharide
          cellular response to alkaloid
          cellular response to glucose stimulus
          cellular response to interleukin-1
          cellular response to tumor necrosis factor
          cellular response to hypoxia
          establishment of Sertoli cell barrier
          regulation of ruffle assembly
          negative regulation of extrinsic apoptotic signaling pathway via death domain receptors
          negative regulation of endothelial cell apoptotic process
          single organismal cell-cell adhesion
          virus receptor activity
          receptor activity
          transmembrane signaling receptor activity
          integrin binding
          protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Chile flag icon
          Chile

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-hznln:80/100.66.79.29:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline