Search
LOADING 
- SNP ID:
- rs201315943
- Gene
-
LOC101928120PBXIP1PYGO2SHC1 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.1: 154963913 - 154963913 on Build GRCh38
- Polymorphism:
- A/G, Transition substitution
- Context Sequence [VIC/FAM]:
ATAAGGTGACTGACACTTTCAAAGC[A/G]GTGATCCTTAGTCCGAACCTGGGAG
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
9 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 606903
MIM: 600560
|
||||||||||||||||||||
Literature Links: |
LOC101928120 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| LOC101928120 - uncharacterized LOC101928120 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| PBXIP1 - PBX homeobox interacting protein 1 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| PYGO2 - pygopus family PHD finger 2 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| SHC1 - SHC adaptor protein 1 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001130040.1 | 3056 | Intron | NP_001123512.1 | |||
| NM_001130041.1 | 3056 | Intron | NP_001123513.1 | |||
| NM_001202859.1 | 3056 | Intron | NP_001189788.1 | |||
| NM_003029.4 | 3056 | Intron | NP_003020.2 | |||
| NM_183001.4 | 3056 | Intron | NP_892113.4 | |||
| XM_005245449.4 | 3056 | Intron | XP_005245506.1 | |||
| XM_005245451.4 | 3056 | Intron | XP_005245508.1 | |||
| XM_011509892.2 | 3056 | Missense Mutation | CGC,TGC | R,C 558 | XP_011508194.1 | |
| XM_011509893.2 | 3056 | Missense Mutation | CGC,TGC | R,C 557 | XP_011508195.1 | |
| XM_011509894.2 | 3056 | Missense Mutation | CGC,TGC | R,C 540 | XP_011508196.1 | |
| XM_011509897.1 | 3056 | Intron | XP_011508199.1 | |||
| XM_011509898.2 | 3056 | Intron | XP_011508200.1 | |||
| XM_017002081.1 | 3056 | Missense Mutation | CGC,TGC | R,C 531 | XP_016857570.1 | |
| XM_017002082.1 | 3056 | Missense Mutation | CGC,TGC | R,C 530 | XP_016857571.1 | |
| XM_017002083.1 | 3056 | Intron | XP_016857572.1 | |||
Back To Top