Search Thermo Fisher Scientific
- Order Status
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
GGGCGGGGCCAGGGCAGCTCTGAGC[C/T]GGCCGCGGCTGCTCTCGCGCTTCCG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 612478 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ACTL10 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ACTL10 - actin like 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
C20orf144 - chromosome 20 open reading frame 144 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_080825.3 | 412 | Missense Mutation | CGG,TGG | R,W 118 | NP_543015.1 |
NECAB3 - N-terminal EF-hand calcium binding protein 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_031231.3 | 412 | Intron | NP_112508.3 | |||
NM_031232.3 | 412 | Intron | NP_112509.3 | |||
XM_005260510.1 | 412 | Intron | XP_005260567.1 | |||
XM_011528991.1 | 412 | Intron | XP_011527293.1 | |||
XM_011528992.2 | 412 | Intron | XP_011527294.1 | |||
XM_017028015.1 | 412 | Intron | XP_016883504.1 | |||
XM_017028016.1 | 412 | Intron | XP_016883505.1 |