Search Thermo Fisher Scientific
- Order Status
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
AAGTGGATGGTGTCGAAGCTGTCCT[A/G]GTCCAGGCTATCCAGGCAGTAGCGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601786 | ||||||||||||||||||||
Literature Links: |
CSDC2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CSDC2 - cold shock domain containing C2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PMM1 - phosphomannomutase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002676.2 | 552 | Nonsense Mutation | CAG,TAG | Q,* 207 | NP_002667.2 | |
XM_005261638.4 | 552 | Nonsense Mutation | CAG,TAG | Q,* 110 | XP_005261695.1 | |
XM_011530229.1 | 552 | Nonsense Mutation | CAG,TAG | Q,* 250 | XP_011528531.1 | |
XM_011530230.2 | 552 | Nonsense Mutation | CAG,TAG | Q,* 212 | XP_011528532.1 | |
XM_011530231.2 | 552 | Nonsense Mutation | CAG,TAG | Q,* 137 | XP_011528533.1 | |
XM_011530232.1 | 552 | Nonsense Mutation | CAG,TAG | Q,* 110 | XP_011528534.1 |