Search Thermo Fisher Scientific
- Order Status
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
GGTGTGCTTGAAGATTGCACAGAGG[A/G]GAGGGCCGAGGAGTTGAAAGAGGCA
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 604264 MIM: 610068 | |||||||||||||||||||||||
Literature Links: |
CELSR3 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
CELSR3 - cadherin EGF LAG seven-pass G-type receptor 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001407.2 | 10056 | Missense Mutation | CCC,TCC | P,S 3259 | NP_001398.2 |
MIR4793 - microRNA 4793 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6824 - microRNA 6824 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC26A6 - solute carrier family 26 member 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |