Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_191262835_10
          See other MECOM GT Assays ›
          SNP ID:
          rs200073118
          Gene
          MECOM
          Gene Name
          MDS1 and EVI1 complex locus
          Set Membership:
          -
          Chromosome Location:
          Chr.3: 169084974 - 169084974 on Build GRCh38
          Polymorphism:
          C/G, Transversion substitution
          Context Sequence [VIC/FAM]:

          GCAGCCCTGGCCATACTGTGCCACA[C/G]GTTGGAAGAACTGTGGGATGTAGAA

          Assay ID C_191262835_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 165215

          Literature Links:

          MECOM PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          MECOM - MDS1 and EVI1 complex locus
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001105077.3 3356 Missense Mutation CTG,GTG L,V 1096 NP_001098547.3
          NM_001105078.3 3356 Missense Mutation CTG,GTG L,V 1031 NP_001098548.2
          NM_001163999.1 3356 Missense Mutation CTG,GTG L,V 1023 NP_001157471.1
          NM_001164000.1 3356 Missense Mutation CTG,GTG L,V 1022 NP_001157472.1
          NM_001205194.1 3356 Missense Mutation CTG,GTG L,V 1031 NP_001192123.1
          NM_004991.3 3356 Missense Mutation CTG,GTG L,V 1219 NP_004982.2
          NM_005241.3 3356 Missense Mutation CTG,GTG L,V 1031 NP_005232.2
          XM_005247213.3 3356 Missense Mutation CTG,GTG L,V 1220 XP_005247270.1
          XM_005247214.3 3356 Missense Mutation CTG,GTG L,V 1211 XP_005247271.1
          XM_005247215.3 3356 Missense Mutation CTG,GTG L,V 1210 XP_005247272.1
          XM_005247219.2 3356 Missense Mutation CTG,GTG L,V 1032 XP_005247276.1
          XM_005247220.2 3356 Missense Mutation CTG,GTG L,V 1032 XP_005247277.1
          XM_005247221.2 3356 Missense Mutation CTG,GTG L,V 1032 XP_005247278.1
          XM_005247223.2 3356 Missense Mutation CTG,GTG L,V 1031 XP_005247280.1
          XM_005247224.3 3356 Missense Mutation CTG,GTG L,V 896 XP_005247281.1
          XM_005247225.3 3356 Missense Mutation CTG,GTG L,V 895 XP_005247282.1
          XM_005247226.3 3356 Missense Mutation CTG,GTG L,V 886 XP_005247283.1
          XM_011512546.2 3356 Missense Mutation CTG,GTG L,V 1104 XP_011510848.1
          XM_017005874.1 3356 Missense Mutation CTG,GTG L,V 1096 XP_016861363.1
          XM_017005875.1 3356 Missense Mutation CTG,GTG L,V 1022 XP_016861364.1
          XM_017005876.1 3356 Missense Mutation CTG,GTG L,V 1023 XP_016861365.1
          XM_017005877.1 3356 Missense Mutation CTG,GTG L,V 887 XP_016861366.1
          XM_017005878.1 3356 Missense Mutation CTG,GTG L,V 698 XP_016861367.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          C2H2 zinc finger transcription factor

          Gene Ontology Categories:

          Function(s) Process(es)

          transcription, DNA-templated
          apoptotic process
          cell differentiation
          histone lysine methylation
          negative regulation of programmed cell death
          negative regulation of transcription, DNA-templated
          positive regulation of transcription, DNA-templated
          negative regulation of JNK cascade
          regulation of cell cycle
          hematopoietic stem cell proliferation
          DNA binding
          transcription factor activity, sequence-specific DNA binding
          protein binding
          histone-lysine N-methyltransferase activity
          metal ion binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-pgj68:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline