Hamburger Menu Button
Thermo Fisher Scientific Logo
Faça o login
Não tem uma conta? Criar Conta​
  • Produtos
    • Consumíveis de Laboratório
    • Equipamentos de Laboratório
    • Instrumentos de Laboratório
    • Clínica & Diagnóstico
    • Cromatografia
    • Espectrômetria de Massas
    • Cultura Celular
    • Análise Celular
    • Anticorpos
    • Biologia Molecular & Análise de Ácidos Nucleicos
    • Produtos Ácidos Nucleicos Específicos de Sequência
    • Veja todas as categorias de produtos
  • Aplicações
    • Cultura Celular e Transfecção
    • Citometria de Fluxo
    • Pesquisa em Oncologia
    • Cromatografia
    • Sequenciamento
    • PCR
    • Soluções Laboratoriais
    • Diagnóstico de Alergias
    • Veja todas as aplicações e técnicas
  • Serviços
    • Serviços de Instrumentos e Equipamentos de Laboratório
    • Serviços Personalizados
    • Serviços de Treinamento
    • Informática de Laboratório em Nível Empresarial
    • Serviços Financeiros e de Arrendamento
    • CDMO & Serviços de Ensaios Clínicos
    • Veja todas as serviços
  • Ajuda e suporte
    • Cadastre-se em nosso site
    • Como fazer o pedido
    • Entre em Contato Conosco
    • Mudança de Localização do Site
    • Veja todos os tópicos de ajuda e suporte
  • Popular
    • Our Instagram
      Nosso Instagram
    • Our Facebook
      Nosso Facebook
    • Blog Behind the Bench
      Blog Behind the Bench
    • Customer Experience Center (CEC)
      Customer Experience Center (CEC)
    • Ecommerce Exclusives
  • Quem atendemos
    • Setor de Biotecnologia
    • Indústria Biofarmacêutica
    • CDMO
    • Diagnósticos Laboratoriais
    • Ciência Industrial e Aplicada
  • Ofertas especiais
  • Fale Conosco
  • Pedido rápido
  • Documentos e certificados
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Fale Conosco
          • Pedido rápido
          • Faça o login
            Faça o login
            Não tem uma conta? Criar Conta​
            • Conta
            • Status do pedido
            • Produtos Customizados & Projetos
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_191416534_10
          See other GALNT7 GT Assays ›
          SNP ID:
          rs202076664
          Gene
          GALNT7 HMGB2 LOC105377538
          Gene Name
          polypeptide N-acetylgalactosaminyltransferase 7
          high mobility group box 2
          uncharacterized LOC105377538
          Set Membership:
          -
          Chromosome Location:
          Chr.4: 173332851 - 173332851 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          CATATTTCTCCTTTAGCTTAGCTGC[C/T]TTCTGTTCATATGGTTGTTTATCTT

          Assay ID C_191416534_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 605005 MIM: 163906

          Literature Links:

          GALNT7 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          GALNT7 - polypeptide N-acetylgalactosaminyltransferase 7
          There are no transcripts associated with this gene.
          HMGB2 - high mobility group box 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001130688.1 574 Silent Mutation AAA,AAG K,K 147 NP_001124160.1
          NM_001130689.1 574 Silent Mutation AAA,AAG K,K 147 NP_001124161.1
          NM_002129.3 574 Silent Mutation AAA,AAG K,K 147 NP_002120.1
          LOC105377538 - uncharacterized LOC105377538
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          positive regulation of endothelial cell proliferation
          inflammatory response to antigenic stimulus
          DNA topological change
          apoptotic DNA fragmentation
          chromatin organization
          nucleosome assembly
          transcription, DNA-templated
          regulation of transcription from RNA polymerase II promoter
          spermatid nucleus differentiation
          male gonad development
          positive regulation of nuclease activity
          DNA geometric change
          response to lipopolysaccharide
          positive regulation of interferon-beta production
          V(D)J recombination
          response to drug
          positive regulation of DNA binding
          innate immune response
          positive regulation of innate immune response
          positive regulation of erythrocyte differentiation
          positive regulation of megakaryocyte differentiation
          negative regulation of transcription, DNA-templated
          positive regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          response to steroid hormone
          regulation of neurogenesis
          defense response to Gram-negative bacterium
          defense response to Gram-positive bacterium
          positive chemotaxis
          DNA ligation involved in DNA repair
          cell chemotaxis
          cellular response to lipopolysaccharide
          regulation of stem cell proliferation
          negative regulation of extrinsic apoptotic signaling pathway via death domain receptors
          four-way junction DNA binding
          enhancer sequence-specific DNA binding
          DNA binding
          damaged DNA binding
          double-stranded DNA binding
          single-stranded DNA binding
          transcription factor activity, sequence-specific DNA binding
          protein binding
          transcription factor binding
          drug binding
          DNA binding, bending
          protein domain specific binding
          chemoattractant activity
          transcription regulatory region DNA binding
          non-sequence-specific DNA binding, bending
          poly(A) RNA binding
          RAGE receptor binding
          supercoiled DNA binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Status do pedido
          • Ajuda para pedidos
          • Pedido rápido
          • Supply Center
          • eProcurement
          Suporte Plus Icon Minus Icon
          • Ajuda e suporte
          • Entre em Contato
          • Centros de Suporte Técnico
          • Obter Documentos e Certificados
          • Informe um Problema no Site
          Recursos Plus Icon Minus Icon
          • Centros de aprendizagem
          • Promoções
          • Eventos & Webinars
          • Mídia Sociais
          Sobre a Thermo Fisher Plus Icon Minus Icon
          • Sobre Nós Sobre Nós
          • Carreiras Carreiras
          • Investidores Investidores
          • Sala de Impresa Sala de Impresa
          • Responsabilidade Social Responsabilidade Social
          • Marcas
          • Políticas e avisos
          Nosso Portfólio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Brasil flag icon
          Brasil

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-zdkzh:80/100.66.76.145:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline